xt microscope control v. 5.5.2 software Search Results


95
Cell Signaling Technology Inc phospho β catenin ser552
RV infection triggers β-Catenin accumulation. Cells infected with RV were harvested at different time points followed by protein expression analysis by Western blotting and Confocal microscopy techniques. ( A ) RV upregulates β-catenin expression during early (3–12 h) hours of infection. Expression of phospho β-catenin Ser37 downregulated in RV infected cells. Expression of phospho β-catenin <t>Ser552</t> upregulated in RV infected cells; ( B ) Changes in the expression levels of different regulators of the Wnt/β-catenin cellular signaling pathway. Expression of ICAT downregulated in RV infected cells. SMAD4 is activated during RV infection and acts as an attenuator of β-catenin proteasomal degradation. The downstream molecule of β-catenin and SMAD4, TCF1/7 and CCND2 are also activated during RV infection; ( C ) Phosphorylation at Ser552 and destabilization of Ser37 induces β-catenin accumulation in the cytoplasm and nucleus as evident from IF imaging. Scale bars: 50 μm.
Phospho β Catenin Ser552, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xt+microscope+control+v%2E+5%2E5%2E2+software/Phospho-beta-Catenin+(Ser552)+Rabbit+mAb/pmc08955121-54-21-23
Average 95 stars, based on 1 article reviews
phospho β catenin ser552 - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

99
MedChemExpress c2c12 myotubes
( A ) Western blot analysis of SH3KBP1 protein levels in total protein extracts obtained from growing (GM) or differentiating <t>C2C12</t> cells (from 1 to 5 days). C2C12 differentiation is assessed by Myogenin expression and Tubulin is used as loading control. ( B ) RT-qPCR analysis of Sh3kbp1 gene expression level relative to housekeeping genes ( CycloB, Gapdh, GusB, Rpl41 , and Tbp ) in proliferating C2C12 cells (GM) or in differentiating C2C12 (1 to 5 days of differentiation). ( C ) Representative western blots analysis of SH3KBP1 protein downregulation in stable cell line constitutively expressing shRNA construct targeting Sh3kbp1 . Tubulin is used as loading control. ( D , E ) Representative immunofluorescence staining of myosin heavy chain (green) and myonuclei (red) in C2C12 stable cell lines expressing scramble shRNA ( D ) or shRNA targeting Sh3kbp1 ( E ) after 3 or 6 days of differentiation. Zooms are magnifications of images in white dots rectangles in 6 days old myotubes. Scale bars: 150 µm, 15 µm in zoom. ( F , G ) Representatives immunofluorescent staining of myosin heavy chain (green) and myonuclei (red) in stable cell line expressing Sh3kbp1 shRNA, co-transfected with plasmid coding either for mCherry ( F ) or the full-length human SH3KBP1 ( G ) after 5 days of differentiation. Scale bar: 150 µm. ( H ) Quantification of the percentage of myonuclei per clusters observed in ( D – G ) experiments. Statistical analysis performed using unpaired t tests where * P < 0.05; ** P < 0.01; *** P < 0.001. Comparison between shRNA Scramble and ShRNA- sh3kbp1 ( n = 8; biological replicates) for the “4–6” nuclei category P = 0.000014, for the “7–9” nuclei category P = 0.039, for the “10–15” nuclei category P = 0.00016 and for the “+ 15” nuclei category P = 0.004. Comparison between ShRNA- sh3kbp1 and ShRNA- sh3kbp1 + SH3KBP1 ( n = 3; biological replicates) for the “4–6” nuclei category P = 0.00008, for the “10–15” nuclei category P = 0.0076 and for the “+ 15” nuclei category P = 0.04. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values.
C2c12 Myotubes, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xt+microscope+control+v%2E+5%2E5%2E2+software/Bafilomycin+A1/pmc12019163-411-8-12
Average 99 stars, based on 1 article reviews
c2c12 myotubes - by Bioz Stars, 2026-10
99/100 stars
  Buy from Supplier

94
Cell Signaling Technology Inc rabbit anti phospho β catenin ser552
FIGURE 3 Early adenoviral factors induce β-catenin transcriptional activity through growth factor signaling. HaCaT cells were infected with Ad5 or replication-incompetent AdlacZ at a MOI of 10 iu/cell and RNA and protein were harvested or cells were fixed for immunofluorescence over a 72 hours time course. A, RT-qPCR analysis of CTNNB1 (β-catenin) relative fold change from 0 hpi. (n = 3). B, Immunofluorescence confocal microscopy for β-catenin (green) and Ad5 (red) with nuclei identified with DAPI (blue). Grayscale images in right panels identify nuclear β-catenin levels through DAPI binary mask multiplication from a single Z-slice. Original magnification: ×100. Scale bar: 10 µm. C, Quantification of nuclear β-catenin represented in B. (n = 5). D, Western blot of total β-catenin and β-catenin <t>phospho-Ser552</t> (transcriptionally active) also probed for Ad5-E1A to confirm infection and α-tubulin for loading control. E, Quantification of D by densitometry. (n = 3). HaCaT cells were transfected with pSF-CAG-empty vector or -E4orf1 and protein harvested 24 hours post transfection. F, Western blot of total β-catenin and β-catenin phospho-Ser552 (transcriptionally active) also probed for GAPDH for loading control. G, Quantification of F by densitometry. (n = 3). Statistical analyses performed using the unpaired Student's t test (A, C, G) or two-way ANOVA with Sidak's multiple comparisons test (E). *P ≤ .05 **P ≤ .01 ***P ≤ .001 ****P < .0001. Data are represented as mean ± SEM. See also Figures S2 and S3
Rabbit Anti Phospho β Catenin Ser552, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xt+microscope+control+v%2E+5%2E5%2E2+software/Phospho-beta-Catenin+(Ser552)+Antibody/10__1096_slash_fj__202000667r-36-51-55
Average 94 stars, based on 1 article reviews
rabbit anti phospho β catenin ser552 - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

91
SignalChem recombinant gst riok2
(A) HEK293 cells were transfected with a plasmid expressing <t>HA-RIOK2</t> or an empty vector (Ctl). HA-RIOK2 was immunoprecipitated from serum-starved cells treated (+) or not (-) with PD184352 for 1h (10 μM) prior to PMA (100 ng/ml, 20 min) or EGF (25 μg/ml, 10 min) stimulation (+). Samples were analyzed by WB using anti-RXRXXpS/T or anti-HA antibodies. (B) RXRXXpS/T ((P)-RIOK2) and total RIOK2 signals obtained in (A) were quantified using ImageLab software and expressed as fold change relative to the PMA condition. Statistically significant differences are indicated by asterisks (*: P≤0.05, One-tailed Mann Whitney test). (C) HA-RIOK2 was immunoprecipitated from serum-starved (Ctl) HEK293 cells treated (PMA+PD) or not (PMA) with PD184352 (10 μM, 1h) prior to PMA stimulation (100 ng/ml, 20 min). Purified HA-RIOK2 was isolated following SDS-PAGE, in gel digested with trypsin and the resulting peptides were submitted to nano-LC-MS/MS analysis. Label-free quantitative analysis of phosphorylation of the different RIOK2 phospho-peptides was performed as specified in the Materials and Methods section. Data are representative of triple biological replicate experiments for each condition. (D) HEK293 cells expressing HA-tagged versions of WT or mutant versions of RIOK2 (T481A or S483A) were serum starved (-) prior to PMA (100 ng/ml, 20 min) stimulation (+). HA-RIOK2 was immunoprecipitated and samples were analyzed by WB as in (A) . (E) RXRXXpS/T ((P)-RIOK2) and total RIOK2 signals obtained in (D) were quantified using ImageLab software and expressed as fold change relative to the WT + PMA condition. Statistically significant differences are indicated by asterisks (*: P≤0.05, One-tailed Mann Whitney test). (F) Serum-starved HEK293 cells were stimulated with different agonists of the MAPK pathway. Phosphorylation of endogenous RIOK2 at Ser483 ((P)-RIOK2) was monitored by WB using specific antibodies. (G) (P)-RIOK2 and total RIOK2 signals obtained in (F) were quantified using ImageLab software and expressed as fold change relative to the starved condition. Statistically significant differences are indicated by asterisks (*: P≤0.05, One-tailed Mann Whitney test).
Recombinant Gst Riok2, supplied by SignalChem, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xt+microscope+control+v%2E+5%2E5%2E2+software/RIOK2+Protein/pmc08224940-375-18-9
Average 91 stars, based on 1 article reviews
recombinant gst riok2 - by Bioz Stars, 2026-10
91/100 stars
  Buy from Supplier

98
Cell Signaling Technology Inc p β catenin ser552 rabbit mab
BoHV-1 infection increased nucleus accumulation of p-c-Jun (S73) <t>and</t> <t>p-β-catenin(S552).</t> MDBK cells in 60 mm dishes were mock infected or infected with BoHV-1 (MOI = 0.1) for 24 h, after which cells were collected for isolation of nuclear proteins and cytosol using a commercial nuclear protein purification kit (Beyotime Biotechnology, cat# P0027). (A) P-β-catenin(S552) and p-c-Jun (S73) in cytosol fractions and whole cell extracts (WCE) were detected by Western blot. Tubulin was detected and used as a protein loading control. (B) β-catenin and c-Jun in the cytosol fractions and whole cell extracts (WCE) were detected by Western blot. Tubulin was detected and used as protein loading control. (C) P-β-catenin(S552) and p-c-Jun (S73) in the nuclear fractions were detected by Western blot. LaminA/C was detected and used as protein loading control. (D) β-catenin and c-Jun in the nucleus fractions were detected by Western blot. LaminA/C was detected and used as protein loading control. (E) LaminA/C in the cytosol fractions and Tubulin in the nucleus fractions were detected by Western blot to determine if these fractions were contaminated by the counterpart fractions. Data shown are representative of three independent experiments.
P β Catenin Ser552 Rabbit Mab, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xt+microscope+control+v%2E+5%2E5%2E2+software/SAPK%2FJNK+Antibody/pmc07414362-47-45-49
Average 98 stars, based on 1 article reviews
p β catenin ser552 rabbit mab - by Bioz Stars, 2026-10
98/100 stars
  Buy from Supplier

99
Nikon ti e microscope
BoHV-1 infection increased nucleus accumulation of p-c-Jun (S73) <t>and</t> <t>p-β-catenin(S552).</t> MDBK cells in 60 mm dishes were mock infected or infected with BoHV-1 (MOI = 0.1) for 24 h, after which cells were collected for isolation of nuclear proteins and cytosol using a commercial nuclear protein purification kit (Beyotime Biotechnology, cat# P0027). (A) P-β-catenin(S552) and p-c-Jun (S73) in cytosol fractions and whole cell extracts (WCE) were detected by Western blot. Tubulin was detected and used as a protein loading control. (B) β-catenin and c-Jun in the cytosol fractions and whole cell extracts (WCE) were detected by Western blot. Tubulin was detected and used as protein loading control. (C) P-β-catenin(S552) and p-c-Jun (S73) in the nuclear fractions were detected by Western blot. LaminA/C was detected and used as protein loading control. (D) β-catenin and c-Jun in the nucleus fractions were detected by Western blot. LaminA/C was detected and used as protein loading control. (E) LaminA/C in the cytosol fractions and Tubulin in the nucleus fractions were detected by Western blot to determine if these fractions were contaminated by the counterpart fractions. Data shown are representative of three independent experiments.
Ti E Microscope, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xt+microscope+control+v%2E+5%2E5%2E2+software/Objectives/10__1128_slash_jb__00061___19-268-16-15
Average 99 stars, based on 1 article reviews
ti e microscope - by Bioz Stars, 2026-10
99/100 stars
  Buy from Supplier

95
Cell Signaling Technology Inc p β catenin
Immunofluorescence staining <t>of</t> <t>phospho-β-catenin</t> (p-β-catenin, Ser 675) in mouse kidneys was performed to determine the state of phosphorus metabolism . Immunofluorescence staining of p-β-catenin at <t>Ser675</t> in mouse renal tissue sections. p-β-catenin was detected using an Alexa Fluor 555-conjugated antibody ( red ); the proximal tubular marker LTL was labeled with FITC ( green ), and nuclei were counterstained with DAPI ( blue ) (N = 6). This scale bar represents 100 μm. Data were acquired using a confocal laser scanning microscope. LTL, Lotus tetragonolobus lectin.
P β Catenin, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xt+microscope+control+v%2E+5%2E5%2E2+software/Phospho-beta-Catenin+(Ser675)+XP+Rabbit+mAb/pmc12803839-284-10-17
Average 95 stars, based on 1 article reviews
p β catenin - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

96
Cytiva Europe amersham cydye cy3 dutp
Immunofluorescence staining <t>of</t> <t>phospho-β-catenin</t> (p-β-catenin, Ser 675) in mouse kidneys was performed to determine the state of phosphorus metabolism . Immunofluorescence staining of p-β-catenin at <t>Ser675</t> in mouse renal tissue sections. p-β-catenin was detected using an Alexa Fluor 555-conjugated antibody ( red ); the proximal tubular marker LTL was labeled with FITC ( green ), and nuclei were counterstained with DAPI ( blue ) (N = 6). This scale bar represents 100 μm. Data were acquired using a confocal laser scanning microscope. LTL, Lotus tetragonolobus lectin.
Amersham Cydye Cy3 Dutp, supplied by Cytiva Europe, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xt+microscope+control+v%2E+5%2E5%2E2+software/Cy3-dUTP/pmc04991238-74-91-98
Average 96 stars, based on 1 article reviews
amersham cydye cy3 dutp - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

96
SouthernBiotech alexa fluor 552 rabbit antibody
Immunofluorescence staining <t>of</t> <t>phospho-β-catenin</t> (p-β-catenin, Ser 675) in mouse kidneys was performed to determine the state of phosphorus metabolism . Immunofluorescence staining of p-β-catenin at <t>Ser675</t> in mouse renal tissue sections. p-β-catenin was detected using an Alexa Fluor 555-conjugated antibody ( red ); the proximal tubular marker LTL was labeled with FITC ( green ), and nuclei were counterstained with DAPI ( blue ) (N = 6). This scale bar represents 100 μm. Data were acquired using a confocal laser scanning microscope. LTL, Lotus tetragonolobus lectin.
Alexa Fluor 552 Rabbit Antibody, supplied by SouthernBiotech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xt+microscope+control+v%2E+5%2E5%2E2+software/DAPI+Fluoromount-G/pm33035574-58-5-19
Average 96 stars, based on 1 article reviews
alexa fluor 552 rabbit antibody - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

95
Santa Cruz Biotechnology baf a1
CEMM disruption promotes autophagic flux (A) HeLa cells were pre-treated with MBCD at the indicated concentration for 1 h, then incubated in the presence or absence of <t>bafilomycin</t> <t>A1</t> (Baf A1, 100 nM) for 2 h. Cell lysates were collected and subjected to western blots for the indicated markers. (B) HeLa cells were pre-treated with or without MBCD (5 mM) for 1 h, then incubated in the presence or absence of <t>Baf</t> <t>A1</t> (100 nM) for the indicated times. Cell lysates were collected and subjected to western blots for the indicated markers. (C) HeLa cells were pre-treated with or without MBCD (5 mM) for 1 h, then incubated in the presence or absence of cholesterol (CHO, 30 μg/mL) or Baf A1 (100 nM) as indicated for 2 h. Cell lysates were collected and subjected to western blots for the indicated markers. (D) HeLa cells with stable expression of GFP-LC3B were pre-treated with or without MBCD (5 mM) for 1 h, then incubated in the presence or absence of amino acid-deficient DMEM medium (AA–), CHO (30 μg/mL), or Baf A1 (100 nM) as indicated. The cells were observed under a confocal microscope (×600). Scale bars, 5 μm. (E) The number of GFP-LC3B puncta observed in (D) are presented as means ± SD. Statistical significance was evaluated using a two-tailed Student's t test. ∗∗∗∗p < 0.0001. (F) Cav1 WT and c av1 KO MEFs were treated with or without Baf A1 (100 nM) for 2 h. The total cell lysates were then immunoblotted with the indicated markers. (G) In the presence or absence of genistein (200 μM), HeLa cells were pre-treated with MBCD (5 mM, 1 h) and then incubated with BSA-Alexa 488 (50 μg/mL). (H) In the presence or absence of genistein (200 μM), Cav1 WT and cav1 KO MEFs were incubated with BSA-Alexa 488 (50 μg/mL). Cells were observed under a confocal microscope. (I) The intracellular uptake of BSA-Alexa 488 (the fluorescence signals inside the cytoplasm) in (G) were analyzed using ImageJ (normalized to control [Ctrl] cells). ∗∗∗∗p < 0.0001. (J) The intracellular uptake of BSA-Alexa 488 (the fluorescence signals inside the cytoplasm) in (H) were analyzed using ImageJ (normalized to WT cells). Statistical significance was evaluated with a two-tailed Student's t test. ∗∗∗∗p < 0.0001. (K) HeLa cells were pre-treated with or without MBCD (5 mM) for 1 h, then incubated in the presence or absence of genistein (200 μM) or Baf A1 (100 nM) as indicated for 2 h. (L) Cav1 WT and cav1 KO MEFs were treated in the presence or absence of genistein (200 μM) or Baf A1 (100 nM) as indicated for 2 h. The total cell lysates were then immunoblotted with the indicated markers.
Baf A1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xt+microscope+control+v%2E+5%2E5%2E2+software/Bafilomycin+A1/pmc08573103-217-14-16
Average 95 stars, based on 1 article reviews
baf a1 - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

97
MedChemExpress enzyme inhibitor tak 243
(A) Immunofluorescence microscopy confirms Cdu1 depletion dynamics. Cdu1 (green, anti-FLAG), chlamydial inclusion (Hsp60,red), and DNA (DAPI, blue). Scale bar = 10 µm. (B) Expansion microscopy (4× expansion) resolving Cdu1 localization patterns under undegraded and degraded conditions. Scale bar = 10 µm. (C) Cdu1 degradation depends on ubiquitin-proteasome and p97 pathways. Host cells were pretreated with inhibitors for 3 hours (including 1 hour during 5-Ph-IAA treatment) with pan-E1 <t>(TAK-243,</t> 1 µM), proteasome (MG-132, 10 µM; bortezomib, 1 µM), or p97 (CB-5083, 10 µM) inhibitors. Degradation was blocked despite 1-hour 5-Ph-IAA exposure. (D) Quantification of inhibitor effects on Cdu1 degradation. FLAG levels (normalized to OmpA, mean ± SD) from three independent immunoblot replicates (one representative in C). Significance assessed by one-way ANOVA with Tukey Multiple comparisons test (*p < 0.05; n.s., not significant). (E) Immunofluorescence validation of inhibitors. Inclusion-localized Cdu1 signal persists in treated cultures. Scale bar = 10 µm. All experiments were replicated ≥3 times with consistent results.
Enzyme Inhibitor Tak 243, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xt+microscope+control+v%2E+5%2E5%2E2+software/TAK-243/bio_rxiv__2025__11__19__688170-233-20-17
Average 97 stars, based on 1 article reviews
enzyme inhibitor tak 243 - by Bioz Stars, 2026-10
97/100 stars
  Buy from Supplier

96
Bio-Rad con a fitc
(A) Immunofluorescence microscopy confirms Cdu1 depletion dynamics. Cdu1 (green, anti-FLAG), chlamydial inclusion (Hsp60,red), and DNA (DAPI, blue). Scale bar = 10 µm. (B) Expansion microscopy (4× expansion) resolving Cdu1 localization patterns under undegraded and degraded conditions. Scale bar = 10 µm. (C) Cdu1 degradation depends on ubiquitin-proteasome and p97 pathways. Host cells were pretreated with inhibitors for 3 hours (including 1 hour during 5-Ph-IAA treatment) with pan-E1 <t>(TAK-243,</t> 1 µM), proteasome (MG-132, 10 µM; bortezomib, 1 µM), or p97 (CB-5083, 10 µM) inhibitors. Degradation was blocked despite 1-hour 5-Ph-IAA exposure. (D) Quantification of inhibitor effects on Cdu1 degradation. FLAG levels (normalized to OmpA, mean ± SD) from three independent immunoblot replicates (one representative in C). Significance assessed by one-way ANOVA with Tukey Multiple comparisons test (*p < 0.05; n.s., not significant). (E) Immunofluorescence validation of inhibitors. Inclusion-localized Cdu1 signal persists in treated cultures. Scale bar = 10 µm. All experiments were replicated ≥3 times with consistent results.
Con A Fitc, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xt+microscope+control+v%2E+5%2E5%2E2+software/Filter/pm17309977-45-30-19
Average 96 stars, based on 1 article reviews
con a fitc - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

Image Search Results


RV infection triggers β-Catenin accumulation. Cells infected with RV were harvested at different time points followed by protein expression analysis by Western blotting and Confocal microscopy techniques. ( A ) RV upregulates β-catenin expression during early (3–12 h) hours of infection. Expression of phospho β-catenin Ser37 downregulated in RV infected cells. Expression of phospho β-catenin Ser552 upregulated in RV infected cells; ( B ) Changes in the expression levels of different regulators of the Wnt/β-catenin cellular signaling pathway. Expression of ICAT downregulated in RV infected cells. SMAD4 is activated during RV infection and acts as an attenuator of β-catenin proteasomal degradation. The downstream molecule of β-catenin and SMAD4, TCF1/7 and CCND2 are also activated during RV infection; ( C ) Phosphorylation at Ser552 and destabilization of Ser37 induces β-catenin accumulation in the cytoplasm and nucleus as evident from IF imaging. Scale bars: 50 μm.

Journal: Viruses

Article Title: Rotavirus-Mediated Suppression of miRNA-192 Family and miRNA-181a Activates Wnt/β-Catenin Signaling Pathway: An In Vitro Study

doi: 10.3390/v14030558

Figure Lengend Snippet: RV infection triggers β-Catenin accumulation. Cells infected with RV were harvested at different time points followed by protein expression analysis by Western blotting and Confocal microscopy techniques. ( A ) RV upregulates β-catenin expression during early (3–12 h) hours of infection. Expression of phospho β-catenin Ser37 downregulated in RV infected cells. Expression of phospho β-catenin Ser552 upregulated in RV infected cells; ( B ) Changes in the expression levels of different regulators of the Wnt/β-catenin cellular signaling pathway. Expression of ICAT downregulated in RV infected cells. SMAD4 is activated during RV infection and acts as an attenuator of β-catenin proteasomal degradation. The downstream molecule of β-catenin and SMAD4, TCF1/7 and CCND2 are also activated during RV infection; ( C ) Phosphorylation at Ser552 and destabilization of Ser37 induces β-catenin accumulation in the cytoplasm and nucleus as evident from IF imaging. Scale bars: 50 μm.

Article Snippet: The membranes were then probed with antibodies specific to the proteins phospho-β-catenin ser33/37 (Santa Cruz Biotechnology, Santa Cruz, CA, USA: 57535); phospho-β-catenin ser552 (Cell Signaling Technology, Danvers, MA, USA: 5651); β-catenin (Cell Signaling Technology, Danvers, MA, USA: 8480); ICAT (Santa Cruz Biotechnology: 293489); SMAD4 (Abcam, Waltham, MA, USA: 110175); TCF1/7 (Cell Signaling Technology, Danvers, MA, USA: 2203); CCND2 (Santa Cruz Biotechnology: 56305); Wnt-1 (Santa Cruz Biotechnology: 514531); Wnt-5a (Santa Cruz Biotechnology: 365370); phospho-LRP6 (Cell Signaling Technology, Danvers, MA, USA: 2568); LRP6 (Cell Signaling Technology, Danvers, MA, USA: 3395); phospho-Axin (Merck Millipore, Burlington, MA, USA: ABN1032); Axin (Santa Cruz Biotechnology: 293190); Naked-1 (Cell Signaling Technology, Danvers, MA, USA: 2201), RV-NSP1 (a kind gift from Prof. Koki Taniguchi); RV-NSP4 (prepared according to the standard protocol from Department of Virology and Parasitology, Fujita Health University School of Medicine, Aichi, Japan); and RV- VP6 (HyTest, Turku, Finland: 3C10).

Techniques: Infection, Expressing, Western Blot, Confocal Microscopy, Phospho-proteomics, Imaging

Wnt-1/Wnt-5a pathway activates during RV infection. ( A ) Expression of Wnt-1 and Wnt-5a have been gradually upregulated during RV infection. LRP6 has also been hyper phosphorylated during RV infection; ( B ) Phosphorylation of Axin and its total component have been reduced in RV infected cells. Expression of Nkd1 is suppressed in RV infected cells; ( C ) Phosphorylation of β-catenin Ser552 significantly inhibited in siRNA-FzD9 treated but RV infected cells. The total β-catenin level is also suppressed. The expressions of Wnt-1 and Wnt-5a are also inhibited in siRNA-FzD9 treated but RV infected cells. This may be the result of negative feedback mechanism of Nkd1 or Axin or may be that some other factors are involved in this pathway. The siRNA-FzD9 restricted the RV infection too, as evident by RV-NSP4 expression.

Journal: Viruses

Article Title: Rotavirus-Mediated Suppression of miRNA-192 Family and miRNA-181a Activates Wnt/β-Catenin Signaling Pathway: An In Vitro Study

doi: 10.3390/v14030558

Figure Lengend Snippet: Wnt-1/Wnt-5a pathway activates during RV infection. ( A ) Expression of Wnt-1 and Wnt-5a have been gradually upregulated during RV infection. LRP6 has also been hyper phosphorylated during RV infection; ( B ) Phosphorylation of Axin and its total component have been reduced in RV infected cells. Expression of Nkd1 is suppressed in RV infected cells; ( C ) Phosphorylation of β-catenin Ser552 significantly inhibited in siRNA-FzD9 treated but RV infected cells. The total β-catenin level is also suppressed. The expressions of Wnt-1 and Wnt-5a are also inhibited in siRNA-FzD9 treated but RV infected cells. This may be the result of negative feedback mechanism of Nkd1 or Axin or may be that some other factors are involved in this pathway. The siRNA-FzD9 restricted the RV infection too, as evident by RV-NSP4 expression.

Article Snippet: The membranes were then probed with antibodies specific to the proteins phospho-β-catenin ser33/37 (Santa Cruz Biotechnology, Santa Cruz, CA, USA: 57535); phospho-β-catenin ser552 (Cell Signaling Technology, Danvers, MA, USA: 5651); β-catenin (Cell Signaling Technology, Danvers, MA, USA: 8480); ICAT (Santa Cruz Biotechnology: 293489); SMAD4 (Abcam, Waltham, MA, USA: 110175); TCF1/7 (Cell Signaling Technology, Danvers, MA, USA: 2203); CCND2 (Santa Cruz Biotechnology: 56305); Wnt-1 (Santa Cruz Biotechnology: 514531); Wnt-5a (Santa Cruz Biotechnology: 365370); phospho-LRP6 (Cell Signaling Technology, Danvers, MA, USA: 2568); LRP6 (Cell Signaling Technology, Danvers, MA, USA: 3395); phospho-Axin (Merck Millipore, Burlington, MA, USA: ABN1032); Axin (Santa Cruz Biotechnology: 293190); Naked-1 (Cell Signaling Technology, Danvers, MA, USA: 2201), RV-NSP1 (a kind gift from Prof. Koki Taniguchi); RV-NSP4 (prepared according to the standard protocol from Department of Virology and Parasitology, Fujita Health University School of Medicine, Aichi, Japan); and RV- VP6 (HyTest, Turku, Finland: 3C10).

Techniques: Infection, Expressing, Phospho-proteomics

( A ) Western blot analysis of SH3KBP1 protein levels in total protein extracts obtained from growing (GM) or differentiating C2C12 cells (from 1 to 5 days). C2C12 differentiation is assessed by Myogenin expression and Tubulin is used as loading control. ( B ) RT-qPCR analysis of Sh3kbp1 gene expression level relative to housekeeping genes ( CycloB, Gapdh, GusB, Rpl41 , and Tbp ) in proliferating C2C12 cells (GM) or in differentiating C2C12 (1 to 5 days of differentiation). ( C ) Representative western blots analysis of SH3KBP1 protein downregulation in stable cell line constitutively expressing shRNA construct targeting Sh3kbp1 . Tubulin is used as loading control. ( D , E ) Representative immunofluorescence staining of myosin heavy chain (green) and myonuclei (red) in C2C12 stable cell lines expressing scramble shRNA ( D ) or shRNA targeting Sh3kbp1 ( E ) after 3 or 6 days of differentiation. Zooms are magnifications of images in white dots rectangles in 6 days old myotubes. Scale bars: 150 µm, 15 µm in zoom. ( F , G ) Representatives immunofluorescent staining of myosin heavy chain (green) and myonuclei (red) in stable cell line expressing Sh3kbp1 shRNA, co-transfected with plasmid coding either for mCherry ( F ) or the full-length human SH3KBP1 ( G ) after 5 days of differentiation. Scale bar: 150 µm. ( H ) Quantification of the percentage of myonuclei per clusters observed in ( D – G ) experiments. Statistical analysis performed using unpaired t tests where * P < 0.05; ** P < 0.01; *** P < 0.001. Comparison between shRNA Scramble and ShRNA- sh3kbp1 ( n = 8; biological replicates) for the “4–6” nuclei category P = 0.000014, for the “7–9” nuclei category P = 0.039, for the “10–15” nuclei category P = 0.00016 and for the “+ 15” nuclei category P = 0.004. Comparison between ShRNA- sh3kbp1 and ShRNA- sh3kbp1 + SH3KBP1 ( n = 3; biological replicates) for the “4–6” nuclei category P = 0.00008, for the “10–15” nuclei category P = 0.0076 and for the “+ 15” nuclei category P = 0.04. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values.

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Western blot analysis of SH3KBP1 protein levels in total protein extracts obtained from growing (GM) or differentiating C2C12 cells (from 1 to 5 days). C2C12 differentiation is assessed by Myogenin expression and Tubulin is used as loading control. ( B ) RT-qPCR analysis of Sh3kbp1 gene expression level relative to housekeeping genes ( CycloB, Gapdh, GusB, Rpl41 , and Tbp ) in proliferating C2C12 cells (GM) or in differentiating C2C12 (1 to 5 days of differentiation). ( C ) Representative western blots analysis of SH3KBP1 protein downregulation in stable cell line constitutively expressing shRNA construct targeting Sh3kbp1 . Tubulin is used as loading control. ( D , E ) Representative immunofluorescence staining of myosin heavy chain (green) and myonuclei (red) in C2C12 stable cell lines expressing scramble shRNA ( D ) or shRNA targeting Sh3kbp1 ( E ) after 3 or 6 days of differentiation. Zooms are magnifications of images in white dots rectangles in 6 days old myotubes. Scale bars: 150 µm, 15 µm in zoom. ( F , G ) Representatives immunofluorescent staining of myosin heavy chain (green) and myonuclei (red) in stable cell line expressing Sh3kbp1 shRNA, co-transfected with plasmid coding either for mCherry ( F ) or the full-length human SH3KBP1 ( G ) after 5 days of differentiation. Scale bar: 150 µm. ( H ) Quantification of the percentage of myonuclei per clusters observed in ( D – G ) experiments. Statistical analysis performed using unpaired t tests where * P < 0.05; ** P < 0.01; *** P < 0.001. Comparison between shRNA Scramble and ShRNA- sh3kbp1 ( n = 8; biological replicates) for the “4–6” nuclei category P = 0.000014, for the “7–9” nuclei category P = 0.039, for the “10–15” nuclei category P = 0.00016 and for the “+ 15” nuclei category P = 0.004. Comparison between ShRNA- sh3kbp1 and ShRNA- sh3kbp1 + SH3KBP1 ( n = 3; biological replicates) for the “4–6” nuclei category P = 0.00008, for the “10–15” nuclei category P = 0.0076 and for the “+ 15” nuclei category P = 0.04. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Western Blot, Expressing, Control, Quantitative RT-PCR, Gene Expression, Stable Transfection, shRNA, Construct, Immunofluorescence, Staining, Transfection, Plasmid Preparation, Comparison, Software

( A ) Representative immunofluorescence staining of 5 days C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA and stained with sirTubulin ® . Scale bars, 10 µm. ( B ) Quantification of the microtubule bundle directionality (orientation angle normalized according to myotubes longitudinal axis) in myotubes using the “directionality plugin” of ImageJ ® . Data are pooled from three independent repeats ( n = 41 cells in scramble condition and n = 61 cells in Sh3kbp1 shRNA condition). “−90°” category P = 0.03; “+80°” category P = 0.02“ + 90°” category P = 0.017. Statistical analysis performed using unpaired t tests where * P < 0.05. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( C, D ) Representative images of immunofluorescent staining of Pericentrin (red), PCM1 (green) and nuclei (Blue) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Scale bars, 10 µm. ( E , F ) Quantification of the myonuclei peripheral staining of Pericentrin ( E ) or PCM1 ( F ) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Data are pooled from three independent repeats. Error bars represent SD ( G ) MAP7 constructs used in the experiment. ( H ) Representative western blot of crude extracts of C2C12 cells expressing various GFP-MAP7 constructs (FL: Full length, NT: N-terminal part of MAP7; NTL: N-terminal long part of MAP7; M: Middle part of MAP7, CT: C-terminal part of MAP7 and CTL: C-terminal long part of MAP7) and GFP-DNM2 and stained for endogenous SH3KBP1 (top) or with anti-GFP (bottom) antibodies. ( I ) Representative western blot after GFP immunoprecipitation (MAP7 and DNM2 constructs) using GFP-Trap in C2C12 cell extracts ( H ). The membrane was revealed with anti-GFP (bottom) and anti-SH3KBP1 (Top) antibodies n .>3.

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Representative immunofluorescence staining of 5 days C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA and stained with sirTubulin ® . Scale bars, 10 µm. ( B ) Quantification of the microtubule bundle directionality (orientation angle normalized according to myotubes longitudinal axis) in myotubes using the “directionality plugin” of ImageJ ® . Data are pooled from three independent repeats ( n = 41 cells in scramble condition and n = 61 cells in Sh3kbp1 shRNA condition). “−90°” category P = 0.03; “+80°” category P = 0.02“ + 90°” category P = 0.017. Statistical analysis performed using unpaired t tests where * P < 0.05. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( C, D ) Representative images of immunofluorescent staining of Pericentrin (red), PCM1 (green) and nuclei (Blue) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Scale bars, 10 µm. ( E , F ) Quantification of the myonuclei peripheral staining of Pericentrin ( E ) or PCM1 ( F ) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Data are pooled from three independent repeats. Error bars represent SD ( G ) MAP7 constructs used in the experiment. ( H ) Representative western blot of crude extracts of C2C12 cells expressing various GFP-MAP7 constructs (FL: Full length, NT: N-terminal part of MAP7; NTL: N-terminal long part of MAP7; M: Middle part of MAP7, CT: C-terminal part of MAP7 and CTL: C-terminal long part of MAP7) and GFP-DNM2 and stained for endogenous SH3KBP1 (top) or with anti-GFP (bottom) antibodies. ( I ) Representative western blot after GFP immunoprecipitation (MAP7 and DNM2 constructs) using GFP-Trap in C2C12 cell extracts ( H ). The membrane was revealed with anti-GFP (bottom) and anti-SH3KBP1 (Top) antibodies n .>3.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Immunofluorescence, Staining, Expressing, shRNA, Software, Construct, Western Blot, Immunoprecipitation, Membrane

( A ) SH3KBP1 constructs used in the experiment. ( B ) Representative western blot of crude extracts of C2C12 cells co-expressing GFP-DNM2 and various Flag-SH3KBP1 constructs (FL full length, N-term N-terminal part of SH3KBP1, C-term C-terminal part of SH3KBP1) and stained with anti-GFP (top) or anti-Flag (bottom) antibodies. ( C ) Representative western blot after DNM2-GFP immunoprecipitation using GFP-Trap and aforementioned C2C12 cell extracts ( B ). The membrane was revealed with anti-GFP (top), anti-Flag (middle) and anti-SH3KBP1 (bottom) antibodies. ( B , C ) Blots were repeated more than three times. ( D ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DNM2 (red) and myonuclei (blue) (single Z plan). Scale bars, 10 µm. ( E ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DHPR1α (for DyHydroPyridine Receptor alpha, red) and myonuclei (blue) (Max intensity of Z stacks plans). Scale bars, 10 µm. ( F ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue) in the time course of C2C12 cells differentiation: proliferation (Prolif) and 3 or 5 days of differentiation (diff day 3, diff day 5) are presented. ( G ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue or red) along the time course of primary myoblasts cells differentiation: proliferation (Prolif) and 3 or 10 days of differentiation (diff day 3, diff day 10) are presented. Scale bars, 10 µm.

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) SH3KBP1 constructs used in the experiment. ( B ) Representative western blot of crude extracts of C2C12 cells co-expressing GFP-DNM2 and various Flag-SH3KBP1 constructs (FL full length, N-term N-terminal part of SH3KBP1, C-term C-terminal part of SH3KBP1) and stained with anti-GFP (top) or anti-Flag (bottom) antibodies. ( C ) Representative western blot after DNM2-GFP immunoprecipitation using GFP-Trap and aforementioned C2C12 cell extracts ( B ). The membrane was revealed with anti-GFP (top), anti-Flag (middle) and anti-SH3KBP1 (bottom) antibodies. ( B , C ) Blots were repeated more than three times. ( D ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DNM2 (red) and myonuclei (blue) (single Z plan). Scale bars, 10 µm. ( E ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DHPR1α (for DyHydroPyridine Receptor alpha, red) and myonuclei (blue) (Max intensity of Z stacks plans). Scale bars, 10 µm. ( F ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue) in the time course of C2C12 cells differentiation: proliferation (Prolif) and 3 or 5 days of differentiation (diff day 3, diff day 5) are presented. ( G ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue or red) along the time course of primary myoblasts cells differentiation: proliferation (Prolif) and 3 or 10 days of differentiation (diff day 3, diff day 10) are presented. Scale bars, 10 µm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Construct, Western Blot, Expressing, Staining, Immunoprecipitation, Membrane

( A , B ) Representative Immunofluorescent staining of Golgi (RCAS1, red) ( A ) or Endoplasmic Reticulum (ERP72, red) ( B ) and myonuclei (DAPI, blue) in 6 days differentiated C2C12 cells expressing either scramble-GFP-shRNA or GFP-shRNA targeting Sh3kbp1 gene. Scale bars, 100 µm. Zooms 1–4 are magnifications of the images in white dots. Scale bars: 100 µm. ( C ) GFP-tagged SH3KBP1 constructs used in the experiment. ( D ) Representative western blot performed on crude extracts of C2C12 cells expressing GFP-SH3KBP1 constructs and stained with anti-ERP72 (Top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. ( E ) Representative western blot performed after SH3KBP1-GFP construct immunoprecipitation (GFP trap assay) of C2C12 cells extracts ( D ) and stained with anti-ERP72 (top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. Blots were repeated more than three times. ( F ) Representative immunofluorescent images of GFP-SH3KBP1 constructs expression in 10 days cultured primary myofibers. (GFP, green; Actin, red and myonuclei, blue) Scale bars, 5 µm. ( G ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes, differentiated for 6 days, were analyzed for their content of LC3-I/LC3-II and SH3KBP1 proteins by western blot; Actin labeling was used as a loading control. ( H ) Fold change quantification of LC3-II/Actin ratios reported to the Scramble condition. ( n = 3; biological replicates) P = 0.002. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( I ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes differentiated for 6 days were either left untreated or treated with 100 nM of bafilomycin-A1 during 6 h. After total protein extraction, LC3-I/LC3-II and Actin levels were analyzed by immunoblot. ( J ) Fold change quantification of LC3-II/Actin ratios reported to the untreated condition in each condition (Scramble or Sh3KBP1) ( n = 3; biological replicates) P = 0.0011. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( K ) Quantification of the percentage of highly LC3-II positive myofibers in Tibialis Anterior muscles from WT or KI- Dnm2 R465W/+ injected with either PBS or shRNA targeting SH3KBP1 mRNA ( n > 3; biological replicates). Comparison between WT and WT-ShRNA- sh3kbp1 P = 0.0059, KI-DNM2 R465W and KI-DNM2 R465W -ShRNA- sh3kbp1 P = 0.0056. Statistical analysis performed using unpaired t tests where ** P < 0.01. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( L ) Representative electron microscopy images of myofibrils and triads organization within Flexor digitalis Brevis muscles from WT mice injected with either PBS or AAV cognate vector expressing shRNA targeting SH3KBP1 mRNA. Scale bar = 0.2 µm or 100 nm.

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A , B ) Representative Immunofluorescent staining of Golgi (RCAS1, red) ( A ) or Endoplasmic Reticulum (ERP72, red) ( B ) and myonuclei (DAPI, blue) in 6 days differentiated C2C12 cells expressing either scramble-GFP-shRNA or GFP-shRNA targeting Sh3kbp1 gene. Scale bars, 100 µm. Zooms 1–4 are magnifications of the images in white dots. Scale bars: 100 µm. ( C ) GFP-tagged SH3KBP1 constructs used in the experiment. ( D ) Representative western blot performed on crude extracts of C2C12 cells expressing GFP-SH3KBP1 constructs and stained with anti-ERP72 (Top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. ( E ) Representative western blot performed after SH3KBP1-GFP construct immunoprecipitation (GFP trap assay) of C2C12 cells extracts ( D ) and stained with anti-ERP72 (top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. Blots were repeated more than three times. ( F ) Representative immunofluorescent images of GFP-SH3KBP1 constructs expression in 10 days cultured primary myofibers. (GFP, green; Actin, red and myonuclei, blue) Scale bars, 5 µm. ( G ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes, differentiated for 6 days, were analyzed for their content of LC3-I/LC3-II and SH3KBP1 proteins by western blot; Actin labeling was used as a loading control. ( H ) Fold change quantification of LC3-II/Actin ratios reported to the Scramble condition. ( n = 3; biological replicates) P = 0.002. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( I ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes differentiated for 6 days were either left untreated or treated with 100 nM of bafilomycin-A1 during 6 h. After total protein extraction, LC3-I/LC3-II and Actin levels were analyzed by immunoblot. ( J ) Fold change quantification of LC3-II/Actin ratios reported to the untreated condition in each condition (Scramble or Sh3KBP1) ( n = 3; biological replicates) P = 0.0011. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( K ) Quantification of the percentage of highly LC3-II positive myofibers in Tibialis Anterior muscles from WT or KI- Dnm2 R465W/+ injected with either PBS or shRNA targeting SH3KBP1 mRNA ( n > 3; biological replicates). Comparison between WT and WT-ShRNA- sh3kbp1 P = 0.0059, KI-DNM2 R465W and KI-DNM2 R465W -ShRNA- sh3kbp1 P = 0.0056. Statistical analysis performed using unpaired t tests where ** P < 0.01. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( L ) Representative electron microscopy images of myofibrils and triads organization within Flexor digitalis Brevis muscles from WT mice injected with either PBS or AAV cognate vector expressing shRNA targeting SH3KBP1 mRNA. Scale bar = 0.2 µm or 100 nm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Staining, Expressing, shRNA, Construct, Western Blot, Immunoprecipitation, TRAP Assay, Cell Culture, Control, Labeling, Protein Extraction, Muscles, Injection, Comparison, Software, Electron Microscopy, Plasmid Preparation

FIGURE 3 Early adenoviral factors induce β-catenin transcriptional activity through growth factor signaling. HaCaT cells were infected with Ad5 or replication-incompetent AdlacZ at a MOI of 10 iu/cell and RNA and protein were harvested or cells were fixed for immunofluorescence over a 72 hours time course. A, RT-qPCR analysis of CTNNB1 (β-catenin) relative fold change from 0 hpi. (n = 3). B, Immunofluorescence confocal microscopy for β-catenin (green) and Ad5 (red) with nuclei identified with DAPI (blue). Grayscale images in right panels identify nuclear β-catenin levels through DAPI binary mask multiplication from a single Z-slice. Original magnification: ×100. Scale bar: 10 µm. C, Quantification of nuclear β-catenin represented in B. (n = 5). D, Western blot of total β-catenin and β-catenin phospho-Ser552 (transcriptionally active) also probed for Ad5-E1A to confirm infection and α-tubulin for loading control. E, Quantification of D by densitometry. (n = 3). HaCaT cells were transfected with pSF-CAG-empty vector or -E4orf1 and protein harvested 24 hours post transfection. F, Western blot of total β-catenin and β-catenin phospho-Ser552 (transcriptionally active) also probed for GAPDH for loading control. G, Quantification of F by densitometry. (n = 3). Statistical analyses performed using the unpaired Student's t test (A, C, G) or two-way ANOVA with Sidak's multiple comparisons test (E). *P ≤ .05 **P ≤ .01 ***P ≤ .001 ****P < .0001. Data are represented as mean ± SEM. See also Figures S2 and S3

Journal: The FASEB Journal

Article Title: Adenovirus targets transcriptional and posttranslational mechanisms to limit gap junction function

doi: 10.1096/fj.202000667r

Figure Lengend Snippet: FIGURE 3 Early adenoviral factors induce β-catenin transcriptional activity through growth factor signaling. HaCaT cells were infected with Ad5 or replication-incompetent AdlacZ at a MOI of 10 iu/cell and RNA and protein were harvested or cells were fixed for immunofluorescence over a 72 hours time course. A, RT-qPCR analysis of CTNNB1 (β-catenin) relative fold change from 0 hpi. (n = 3). B, Immunofluorescence confocal microscopy for β-catenin (green) and Ad5 (red) with nuclei identified with DAPI (blue). Grayscale images in right panels identify nuclear β-catenin levels through DAPI binary mask multiplication from a single Z-slice. Original magnification: ×100. Scale bar: 10 µm. C, Quantification of nuclear β-catenin represented in B. (n = 5). D, Western blot of total β-catenin and β-catenin phospho-Ser552 (transcriptionally active) also probed for Ad5-E1A to confirm infection and α-tubulin for loading control. E, Quantification of D by densitometry. (n = 3). HaCaT cells were transfected with pSF-CAG-empty vector or -E4orf1 and protein harvested 24 hours post transfection. F, Western blot of total β-catenin and β-catenin phospho-Ser552 (transcriptionally active) also probed for GAPDH for loading control. G, Quantification of F by densitometry. (n = 3). Statistical analyses performed using the unpaired Student's t test (A, C, G) or two-way ANOVA with Sidak's multiple comparisons test (E). *P ≤ .05 **P ≤ .01 ***P ≤ .001 ****P < .0001. Data are represented as mean ± SEM. See also Figures S2 and S3

Article Snippet: Primary antibody labeling was performed overnight at 4°C using primary antibodies rabbit anti-Cx43 (1:5000; Sigma-Aldrich, St. Louis, MO, USA), mouse anti-α-tubulin (1:5000; Sigma Aldrich, St. Louis, MO, USA), mouse antiGAPDH (1:2000; Fitzgerald Industry International, Acton, MA, USA), mouse anti-Adenovirus Hexon [8C4] (1:5000; Abcam, Cambridge, UK), mouse anti-β-catenin (1:200; Santa Cruz Biotechnology), rabbit anti-phospho-β-catenin (Ser552) (1:1000; Cell Signaling Technology, Danvers, MA, USA), mouse anti-Adenovirus E1A [M73] (1:2000; Abcam, Cambridge, UK), mouse anti-phospho-(Ser) 14-3-3 Mode 1 binding motif (1:1000; Cell Signaling Technology, Danvers, MA, USA), rabbit anti-phospho-Cx43(Ser368) (1:1000; Cell Signaling Technology, Danvers, MA, USA), mouse anti-ZO-1 (1:1000, BD Biosciences, San Jose, CA, USA), mouse anti-ECadherin (1:1000; BD Diagnostics, Franklin Lakes, NJ, USA), rabbit anti-CAR (1:500; Cell Signaling Technology, Danvers, MA, USA), goat anti-RPL22 (1:800; Abcam, Cambridge, UK), mouse anti-Cx40 (1:500; Thermo Fisher, Waltham, MA, USA), rabbit anti-Cx45 (1:500; Novus Biologicals, Littleton, CO, USA), and rabbit anti-phospho-Cx43(Ser262) (1:1000; Santa Cruz Biotechnology, Dallas, TX, USA).

Techniques: Activity Assay, Infection, Immunofluorescence, Quantitative RT-PCR, Confocal Microscopy, Western Blot, Control, Transfection, Plasmid Preparation

(A) HEK293 cells were transfected with a plasmid expressing HA-RIOK2 or an empty vector (Ctl). HA-RIOK2 was immunoprecipitated from serum-starved cells treated (+) or not (-) with PD184352 for 1h (10 μM) prior to PMA (100 ng/ml, 20 min) or EGF (25 μg/ml, 10 min) stimulation (+). Samples were analyzed by WB using anti-RXRXXpS/T or anti-HA antibodies. (B) RXRXXpS/T ((P)-RIOK2) and total RIOK2 signals obtained in (A) were quantified using ImageLab software and expressed as fold change relative to the PMA condition. Statistically significant differences are indicated by asterisks (*: P≤0.05, One-tailed Mann Whitney test). (C) HA-RIOK2 was immunoprecipitated from serum-starved (Ctl) HEK293 cells treated (PMA+PD) or not (PMA) with PD184352 (10 μM, 1h) prior to PMA stimulation (100 ng/ml, 20 min). Purified HA-RIOK2 was isolated following SDS-PAGE, in gel digested with trypsin and the resulting peptides were submitted to nano-LC-MS/MS analysis. Label-free quantitative analysis of phosphorylation of the different RIOK2 phospho-peptides was performed as specified in the Materials and Methods section. Data are representative of triple biological replicate experiments for each condition. (D) HEK293 cells expressing HA-tagged versions of WT or mutant versions of RIOK2 (T481A or S483A) were serum starved (-) prior to PMA (100 ng/ml, 20 min) stimulation (+). HA-RIOK2 was immunoprecipitated and samples were analyzed by WB as in (A) . (E) RXRXXpS/T ((P)-RIOK2) and total RIOK2 signals obtained in (D) were quantified using ImageLab software and expressed as fold change relative to the WT + PMA condition. Statistically significant differences are indicated by asterisks (*: P≤0.05, One-tailed Mann Whitney test). (F) Serum-starved HEK293 cells were stimulated with different agonists of the MAPK pathway. Phosphorylation of endogenous RIOK2 at Ser483 ((P)-RIOK2) was monitored by WB using specific antibodies. (G) (P)-RIOK2 and total RIOK2 signals obtained in (F) were quantified using ImageLab software and expressed as fold change relative to the starved condition. Statistically significant differences are indicated by asterisks (*: P≤0.05, One-tailed Mann Whitney test).

Journal: PLoS Genetics

Article Title: RIOK2 phosphorylation by RSK promotes synthesis of the human small ribosomal subunit

doi: 10.1371/journal.pgen.1009583

Figure Lengend Snippet: (A) HEK293 cells were transfected with a plasmid expressing HA-RIOK2 or an empty vector (Ctl). HA-RIOK2 was immunoprecipitated from serum-starved cells treated (+) or not (-) with PD184352 for 1h (10 μM) prior to PMA (100 ng/ml, 20 min) or EGF (25 μg/ml, 10 min) stimulation (+). Samples were analyzed by WB using anti-RXRXXpS/T or anti-HA antibodies. (B) RXRXXpS/T ((P)-RIOK2) and total RIOK2 signals obtained in (A) were quantified using ImageLab software and expressed as fold change relative to the PMA condition. Statistically significant differences are indicated by asterisks (*: P≤0.05, One-tailed Mann Whitney test). (C) HA-RIOK2 was immunoprecipitated from serum-starved (Ctl) HEK293 cells treated (PMA+PD) or not (PMA) with PD184352 (10 μM, 1h) prior to PMA stimulation (100 ng/ml, 20 min). Purified HA-RIOK2 was isolated following SDS-PAGE, in gel digested with trypsin and the resulting peptides were submitted to nano-LC-MS/MS analysis. Label-free quantitative analysis of phosphorylation of the different RIOK2 phospho-peptides was performed as specified in the Materials and Methods section. Data are representative of triple biological replicate experiments for each condition. (D) HEK293 cells expressing HA-tagged versions of WT or mutant versions of RIOK2 (T481A or S483A) were serum starved (-) prior to PMA (100 ng/ml, 20 min) stimulation (+). HA-RIOK2 was immunoprecipitated and samples were analyzed by WB as in (A) . (E) RXRXXpS/T ((P)-RIOK2) and total RIOK2 signals obtained in (D) were quantified using ImageLab software and expressed as fold change relative to the WT + PMA condition. Statistically significant differences are indicated by asterisks (*: P≤0.05, One-tailed Mann Whitney test). (F) Serum-starved HEK293 cells were stimulated with different agonists of the MAPK pathway. Phosphorylation of endogenous RIOK2 at Ser483 ((P)-RIOK2) was monitored by WB using specific antibodies. (G) (P)-RIOK2 and total RIOK2 signals obtained in (F) were quantified using ImageLab software and expressed as fold change relative to the starved condition. Statistically significant differences are indicated by asterisks (*: P≤0.05, One-tailed Mann Whitney test).

Article Snippet: For RSK kinase assays, human recombinant-activated RSK1 purchased from SignalChem (Catalog # R15-10G) was used with bacterially purified recombinant GST-RIOK2 (aa 443–552) as substrate (WT and S483A), under linear assay conditions.

Techniques: Transfection, Plasmid Preparation, Expressing, Immunoprecipitation, Software, One-tailed Test, MANN-WHITNEY, Purification, Isolation, SDS Page, Liquid Chromatography with Mass Spectroscopy, Mutagenesis

(A) Serum-starved (Ctl) HEK293 cells were treated or not (-) with PD184352 (PD), or LJH685 (10 μM) (LJH) for 1 h prior to PMA stimulation (100 ng/ml, 20 min). Phosphorylation of endogenous RIOK2 at Ser483 ((P)-RIOK2) was monitored by WB using specific antibodies. (B) (P)-RIOK2 and total RIOK2 signals obtained in (A) were quantified using ImageLab software and expressed as fold change relative to the PMA condition. Statistically significant differences are indicated by asterisks (*: P≤0.05, One-tailed Mann Whitney test). (C) HEK293 cells were transfected with vectors over-expressing HA-tagged RSK1, RSK2, RSK3 or RSK4, or the empty vector (Ctl). Following serum-starvation and PMA stimulation (100 ng/ml, 20 min), samples were analyzed by WB using the indicated antibodies. (D) (P)-RIOK2 and total RIOK2 signals obtained in (C) were quantified using ImageLab software and expressed as fold change relative to starved Ctl cells. Statistically significant differences between starved conditions relative to starved Ctl cells are indicated by hashes, and between PMA stimulated conditions relative to stimulated Ctl cells by asterisks (#/*: P≤0.05, ns: not statistically significant, One-tailed Mann Whitney test). (E) HEK293 cells expressing shRNA targeting an irrelevant sequence (Ctl) or both RSK1 and RSK2 (RSK1/2) were processed as in (C) . (F) (P)-RIOK2 and total RIOK2 signals obtained in (E) were quantified using ImageLab software and expressed as fold change relative to the starved condition. Statistically significant differences are indicated by asterisks (*: P≤0.05, One-tailed Mann Whitney test). (G) Human activated RSK1 was incubated in the presence of γ[ 32 P]-ATP with either GST alone, or a GST-RIOK2 peptide (D443-E552) containing either S483 (RIOK2 WT ) or the non-phosphorylatable version (RIOK2 S483A ). The resulting samples were analyzed by SDS-PAGE and revealed by autoradiography or Coomassie blue staining. Quantification of [ 32 P] incorporation within each peptide is expressed as n-fold change compared to the absence of RSK1. (H) In vitro kinase assays performed as in (G) in the presence or not of RSK inhibitors BI-D1870 or LJH685 (10 mM).

Journal: PLoS Genetics

Article Title: RIOK2 phosphorylation by RSK promotes synthesis of the human small ribosomal subunit

doi: 10.1371/journal.pgen.1009583

Figure Lengend Snippet: (A) Serum-starved (Ctl) HEK293 cells were treated or not (-) with PD184352 (PD), or LJH685 (10 μM) (LJH) for 1 h prior to PMA stimulation (100 ng/ml, 20 min). Phosphorylation of endogenous RIOK2 at Ser483 ((P)-RIOK2) was monitored by WB using specific antibodies. (B) (P)-RIOK2 and total RIOK2 signals obtained in (A) were quantified using ImageLab software and expressed as fold change relative to the PMA condition. Statistically significant differences are indicated by asterisks (*: P≤0.05, One-tailed Mann Whitney test). (C) HEK293 cells were transfected with vectors over-expressing HA-tagged RSK1, RSK2, RSK3 or RSK4, or the empty vector (Ctl). Following serum-starvation and PMA stimulation (100 ng/ml, 20 min), samples were analyzed by WB using the indicated antibodies. (D) (P)-RIOK2 and total RIOK2 signals obtained in (C) were quantified using ImageLab software and expressed as fold change relative to starved Ctl cells. Statistically significant differences between starved conditions relative to starved Ctl cells are indicated by hashes, and between PMA stimulated conditions relative to stimulated Ctl cells by asterisks (#/*: P≤0.05, ns: not statistically significant, One-tailed Mann Whitney test). (E) HEK293 cells expressing shRNA targeting an irrelevant sequence (Ctl) or both RSK1 and RSK2 (RSK1/2) were processed as in (C) . (F) (P)-RIOK2 and total RIOK2 signals obtained in (E) were quantified using ImageLab software and expressed as fold change relative to the starved condition. Statistically significant differences are indicated by asterisks (*: P≤0.05, One-tailed Mann Whitney test). (G) Human activated RSK1 was incubated in the presence of γ[ 32 P]-ATP with either GST alone, or a GST-RIOK2 peptide (D443-E552) containing either S483 (RIOK2 WT ) or the non-phosphorylatable version (RIOK2 S483A ). The resulting samples were analyzed by SDS-PAGE and revealed by autoradiography or Coomassie blue staining. Quantification of [ 32 P] incorporation within each peptide is expressed as n-fold change compared to the absence of RSK1. (H) In vitro kinase assays performed as in (G) in the presence or not of RSK inhibitors BI-D1870 or LJH685 (10 mM).

Article Snippet: For RSK kinase assays, human recombinant-activated RSK1 purchased from SignalChem (Catalog # R15-10G) was used with bacterially purified recombinant GST-RIOK2 (aa 443–552) as substrate (WT and S483A), under linear assay conditions.

Techniques: Software, One-tailed Test, MANN-WHITNEY, Transfection, Expressing, Plasmid Preparation, shRNA, Sequencing, Incubation, SDS Page, Autoradiography, Staining, In Vitro

(A) MTS assays were performed on Control (Ctl) and RIOK2 S483A (1 to 3) eHAP1 cell lines at the indicated time points. ODs at 490 nm were measured using Spectramax. (B) Control (Ctl) and RIOK2 S483A (1 to 3) eHAP1 cell lines were incubated with 1 μM puromycin for the indicated times. Levels of puromycin-labelled peptides were monitored by WB using anti-puromycin antibodies. WB signals were quantified using ImageLab software and expressed as arbitrary units (a.u.). (C) , Total cellular RNAs were extracted from control (Ctl), RIOK2 S483A (1 to 3) or RIOK2 S483D eHAP1 cell lines. Accumulation levels of pre-rRNAs and mature rRNAs were analyzed by NB as in . (D) RAMP analyses of pre-rRNA levels obtained in (C) normalized to the 26S signals after quantification using MultiGauge software (Fujifilm). Graphical representations show fold changes compared to the control condition (Ctl). Statistically significant differences are indicated by asterisks (***: P≤0.001, *: P≤0.05, Two-way ANOVA, Bonferroni posttests). (E) FISH experiments performed on RIOK2 WT (Ctl) and RIOK2 S483A eHAP1 cell lines. Pre-rRNAs were detected using a Cy5-labeled 5’-ITS1 probe. Cells were stained with DAPI to visualize nuclei, and images were captured in identical setting conditions. (F) Nucleolar, nuclear and cytoplasmic fluorescence signals were quantified using ImageJ software, as described in the “Materials and Methods” section and . Graph representations show fold change in RIOK2 S483A relative to RIOK2 WT cell line (n = 100 cells from different fields). Statistically significant differences are indicated by asterisks (***: P≤0.001, **: P≤0.01, *: P≤0.05, One-tailed Mann Whitney test).

Journal: PLoS Genetics

Article Title: RIOK2 phosphorylation by RSK promotes synthesis of the human small ribosomal subunit

doi: 10.1371/journal.pgen.1009583

Figure Lengend Snippet: (A) MTS assays were performed on Control (Ctl) and RIOK2 S483A (1 to 3) eHAP1 cell lines at the indicated time points. ODs at 490 nm were measured using Spectramax. (B) Control (Ctl) and RIOK2 S483A (1 to 3) eHAP1 cell lines were incubated with 1 μM puromycin for the indicated times. Levels of puromycin-labelled peptides were monitored by WB using anti-puromycin antibodies. WB signals were quantified using ImageLab software and expressed as arbitrary units (a.u.). (C) , Total cellular RNAs were extracted from control (Ctl), RIOK2 S483A (1 to 3) or RIOK2 S483D eHAP1 cell lines. Accumulation levels of pre-rRNAs and mature rRNAs were analyzed by NB as in . (D) RAMP analyses of pre-rRNA levels obtained in (C) normalized to the 26S signals after quantification using MultiGauge software (Fujifilm). Graphical representations show fold changes compared to the control condition (Ctl). Statistically significant differences are indicated by asterisks (***: P≤0.001, *: P≤0.05, Two-way ANOVA, Bonferroni posttests). (E) FISH experiments performed on RIOK2 WT (Ctl) and RIOK2 S483A eHAP1 cell lines. Pre-rRNAs were detected using a Cy5-labeled 5’-ITS1 probe. Cells were stained with DAPI to visualize nuclei, and images were captured in identical setting conditions. (F) Nucleolar, nuclear and cytoplasmic fluorescence signals were quantified using ImageJ software, as described in the “Materials and Methods” section and . Graph representations show fold change in RIOK2 S483A relative to RIOK2 WT cell line (n = 100 cells from different fields). Statistically significant differences are indicated by asterisks (***: P≤0.001, **: P≤0.01, *: P≤0.05, One-tailed Mann Whitney test).

Article Snippet: For RSK kinase assays, human recombinant-activated RSK1 purchased from SignalChem (Catalog # R15-10G) was used with bacterially purified recombinant GST-RIOK2 (aa 443–552) as substrate (WT and S483A), under linear assay conditions.

Techniques: Incubation, Software, Labeling, Staining, Fluorescence, One-tailed Test, MANN-WHITNEY

(A) RIOK2 localization was analyzed by IF microscopy using anti-RIOK2 antibodies in RIOK2 WT (Ctl) and RIOK2 S483A eHAP1 cell lines. Nuclei were visualized by DAPI staining. (B) Quantification of fluorescence observed in (A) using ImageJ software, as described in , and expressed as fold change relative to Ctl (n = 100 cells from different fields). Statistically significant differences are indicated by asterisks (***: P<0.0001, One-tailed Mann Whitney test). (C) Nucleo-cytoplasmic fractionation of serum-growing RIOK2 WT (Ctl) and RIOK2 S483A eHAP1 cell lines. RIOK2 levels in the different fractions (total cell extract, cytoplasm, nucleus) were analyzed by WB. Fractionation quality was validated using antibodies detecting tubulin (cytoplasmic protein) and fibrillarin (nuclear protein). (D) WB signals obtained in the cytoplasmic and nuclear fractions from (C) were quantified. The graph represents cytoplasmic/nuclear intensity ratios. Statistically significant differences are indicated by asterisks (*: P≤0.05, One-tailed Mann Whitney test). (E) HEK293 cells were transfected with plasmids expressing HA-tagged RIOK2 WT or RIOK2 S483A , or with empty vector (-). HA-RIOK2 was immunoprecipitated and co-immunoprecipitated proteins and 18S-E pre-rRNA were analyzed by WB and NB, respectively. (F) Quantification of the WB and NB signals obtained in (E) expressed as fold change compared to immunoprecipitated HA-RIOK2 WT . (G) HEK293 cells were co-transfected with plasmids expressing HA-NOB1 and either Flag-RIOK2 WT or Flag-RIOK2 S483A . HA-NOB1 was immunoprecipitated and the co-immunoprecipitated proteins were analyzed by WB.

Journal: PLoS Genetics

Article Title: RIOK2 phosphorylation by RSK promotes synthesis of the human small ribosomal subunit

doi: 10.1371/journal.pgen.1009583

Figure Lengend Snippet: (A) RIOK2 localization was analyzed by IF microscopy using anti-RIOK2 antibodies in RIOK2 WT (Ctl) and RIOK2 S483A eHAP1 cell lines. Nuclei were visualized by DAPI staining. (B) Quantification of fluorescence observed in (A) using ImageJ software, as described in , and expressed as fold change relative to Ctl (n = 100 cells from different fields). Statistically significant differences are indicated by asterisks (***: P<0.0001, One-tailed Mann Whitney test). (C) Nucleo-cytoplasmic fractionation of serum-growing RIOK2 WT (Ctl) and RIOK2 S483A eHAP1 cell lines. RIOK2 levels in the different fractions (total cell extract, cytoplasm, nucleus) were analyzed by WB. Fractionation quality was validated using antibodies detecting tubulin (cytoplasmic protein) and fibrillarin (nuclear protein). (D) WB signals obtained in the cytoplasmic and nuclear fractions from (C) were quantified. The graph represents cytoplasmic/nuclear intensity ratios. Statistically significant differences are indicated by asterisks (*: P≤0.05, One-tailed Mann Whitney test). (E) HEK293 cells were transfected with plasmids expressing HA-tagged RIOK2 WT or RIOK2 S483A , or with empty vector (-). HA-RIOK2 was immunoprecipitated and co-immunoprecipitated proteins and 18S-E pre-rRNA were analyzed by WB and NB, respectively. (F) Quantification of the WB and NB signals obtained in (E) expressed as fold change compared to immunoprecipitated HA-RIOK2 WT . (G) HEK293 cells were co-transfected with plasmids expressing HA-NOB1 and either Flag-RIOK2 WT or Flag-RIOK2 S483A . HA-NOB1 was immunoprecipitated and the co-immunoprecipitated proteins were analyzed by WB.

Article Snippet: For RSK kinase assays, human recombinant-activated RSK1 purchased from SignalChem (Catalog # R15-10G) was used with bacterially purified recombinant GST-RIOK2 (aa 443–552) as substrate (WT and S483A), under linear assay conditions.

Techniques: Microscopy, Staining, Fluorescence, Software, One-tailed Test, MANN-WHITNEY, Fractionation, Transfection, Expressing, Plasmid Preparation, Immunoprecipitation

(A) HEK293 cells were co-transfected with plasmids expressing HA-NOB1 and Flag-RIOK2 WT , Flag-RIOK2 S483A or Flag-RIOK2 S483D . Pre-40S particles were immunopurified via HA-NOB1 and subsequently incubated for 45 or 90 min with a buffer inducing RIOK2 release at 16°C. The presence of RIOK2, LTV1 and RPS7 proteins in supernatants (released proteins) and on beads (pre-40S-bound proteins) were analyzed by WB. Experiments with Flag-RIOK2 S483A and Flag-RIOK2 S483D were performed with different sets of Flag-RIOK2 WT as controls. A representative WB experiment for Flag-RIOK2 WT is shown. (B) Quantification of WB signals from (A) using ImageLab software and expressed as released over bound RIOK2 ratios. Statistically significant differences are indicated by asterisks (***: P≤0.001, **: P≤0.01, Two-way ANOVA test, Bonferroni posttests). (C) RIOK2 WT and RIOK2 S483A eHAP1 cells were treated with Leptomycin B (LMB, 20 nM) for the indicated times. Subcellular localization of RIOK2 was monitored by immunofluorescence microscopy using specific antibodies. Nuclei were visualized by DAPI staining. (D) , Quantification of nuclear to cytoplasmic fluorescence ratios at the indicated time points obtained in (C) using ImageJ software (n = 100 cells from different fields), as described in . Statistically significant differences are indicated by asterisks (***: P≤0.001, *: P≤0.05, 2way ANOVA tests, Bonferroni posttests).

Journal: PLoS Genetics

Article Title: RIOK2 phosphorylation by RSK promotes synthesis of the human small ribosomal subunit

doi: 10.1371/journal.pgen.1009583

Figure Lengend Snippet: (A) HEK293 cells were co-transfected with plasmids expressing HA-NOB1 and Flag-RIOK2 WT , Flag-RIOK2 S483A or Flag-RIOK2 S483D . Pre-40S particles were immunopurified via HA-NOB1 and subsequently incubated for 45 or 90 min with a buffer inducing RIOK2 release at 16°C. The presence of RIOK2, LTV1 and RPS7 proteins in supernatants (released proteins) and on beads (pre-40S-bound proteins) were analyzed by WB. Experiments with Flag-RIOK2 S483A and Flag-RIOK2 S483D were performed with different sets of Flag-RIOK2 WT as controls. A representative WB experiment for Flag-RIOK2 WT is shown. (B) Quantification of WB signals from (A) using ImageLab software and expressed as released over bound RIOK2 ratios. Statistically significant differences are indicated by asterisks (***: P≤0.001, **: P≤0.01, Two-way ANOVA test, Bonferroni posttests). (C) RIOK2 WT and RIOK2 S483A eHAP1 cells were treated with Leptomycin B (LMB, 20 nM) for the indicated times. Subcellular localization of RIOK2 was monitored by immunofluorescence microscopy using specific antibodies. Nuclei were visualized by DAPI staining. (D) , Quantification of nuclear to cytoplasmic fluorescence ratios at the indicated time points obtained in (C) using ImageJ software (n = 100 cells from different fields), as described in . Statistically significant differences are indicated by asterisks (***: P≤0.001, *: P≤0.05, 2way ANOVA tests, Bonferroni posttests).

Article Snippet: For RSK kinase assays, human recombinant-activated RSK1 purchased from SignalChem (Catalog # R15-10G) was used with bacterially purified recombinant GST-RIOK2 (aa 443–552) as substrate (WT and S483A), under linear assay conditions.

Techniques: Transfection, Expressing, Incubation, Software, Immunofluorescence, Microscopy, Staining, Fluorescence

RIOK2 is incorporated into pre-40S particles in the nucleus and participates to their export to the cytoplasm. Phosphorylation of RIOK2 by RSK at Ser483 facilitates its dissociation from pre-40S particles, which allows simultaneous or subsequent dissociation of other factors (ENP1, LTV1, DIM2, NOB1) to promote efficient maturation of the 18S-E pre-rRNA. This phosphorylation event is required for optimal protein synthesis and cell proliferation.

Journal: PLoS Genetics

Article Title: RIOK2 phosphorylation by RSK promotes synthesis of the human small ribosomal subunit

doi: 10.1371/journal.pgen.1009583

Figure Lengend Snippet: RIOK2 is incorporated into pre-40S particles in the nucleus and participates to their export to the cytoplasm. Phosphorylation of RIOK2 by RSK at Ser483 facilitates its dissociation from pre-40S particles, which allows simultaneous or subsequent dissociation of other factors (ENP1, LTV1, DIM2, NOB1) to promote efficient maturation of the 18S-E pre-rRNA. This phosphorylation event is required for optimal protein synthesis and cell proliferation.

Article Snippet: For RSK kinase assays, human recombinant-activated RSK1 purchased from SignalChem (Catalog # R15-10G) was used with bacterially purified recombinant GST-RIOK2 (aa 443–552) as substrate (WT and S483A), under linear assay conditions.

Techniques:

BoHV-1 infection increased nucleus accumulation of p-c-Jun (S73) and p-β-catenin(S552). MDBK cells in 60 mm dishes were mock infected or infected with BoHV-1 (MOI = 0.1) for 24 h, after which cells were collected for isolation of nuclear proteins and cytosol using a commercial nuclear protein purification kit (Beyotime Biotechnology, cat# P0027). (A) P-β-catenin(S552) and p-c-Jun (S73) in cytosol fractions and whole cell extracts (WCE) were detected by Western blot. Tubulin was detected and used as a protein loading control. (B) β-catenin and c-Jun in the cytosol fractions and whole cell extracts (WCE) were detected by Western blot. Tubulin was detected and used as protein loading control. (C) P-β-catenin(S552) and p-c-Jun (S73) in the nuclear fractions were detected by Western blot. LaminA/C was detected and used as protein loading control. (D) β-catenin and c-Jun in the nucleus fractions were detected by Western blot. LaminA/C was detected and used as protein loading control. (E) LaminA/C in the cytosol fractions and Tubulin in the nucleus fractions were detected by Western blot to determine if these fractions were contaminated by the counterpart fractions. Data shown are representative of three independent experiments.

Journal: Veterinary Microbiology

Article Title: β-cantenin is potentially involved in the regulation of c-Jun signaling following bovine herpesvirus 1 infection

doi: 10.1016/j.vetmic.2020.108804

Figure Lengend Snippet: BoHV-1 infection increased nucleus accumulation of p-c-Jun (S73) and p-β-catenin(S552). MDBK cells in 60 mm dishes were mock infected or infected with BoHV-1 (MOI = 0.1) for 24 h, after which cells were collected for isolation of nuclear proteins and cytosol using a commercial nuclear protein purification kit (Beyotime Biotechnology, cat# P0027). (A) P-β-catenin(S552) and p-c-Jun (S73) in cytosol fractions and whole cell extracts (WCE) were detected by Western blot. Tubulin was detected and used as a protein loading control. (B) β-catenin and c-Jun in the cytosol fractions and whole cell extracts (WCE) were detected by Western blot. Tubulin was detected and used as protein loading control. (C) P-β-catenin(S552) and p-c-Jun (S73) in the nuclear fractions were detected by Western blot. LaminA/C was detected and used as protein loading control. (D) β-catenin and c-Jun in the nucleus fractions were detected by Western blot. LaminA/C was detected and used as protein loading control. (E) LaminA/C in the cytosol fractions and Tubulin in the nucleus fractions were detected by Western blot to determine if these fractions were contaminated by the counterpart fractions. Data shown are representative of three independent experiments.

Article Snippet: The following antibodies were used in this study: phospho(p)-c-Jun (Ser73) rabbit monoclonal antibody (Cell Signaling Technology, cat# 3270), c-Jun rabbit mAb (Cell Signaling Technology, cat# 9165), p-JNK (Thr183/Tyr185) rabbit mAb (Cell Signaling Technology, cat# 9251), JNK rabbit polyclonal antibody (pAb) (Cell Signaling Technology, cat# 9252). p-β-catenin (Ser552) rabbit mAb (Cell Signaling Technology, cat# 9566). β-catenin (Ser552) rabbit mAb (Abcam, cat# ab32572), mouse control IgG (ABclonal, cat# AC011), rabbit control IgG (ABclonal, cat# AC005), laminA/C mouse mAb (Santa Cruz Biotechnology, cat# sc-376248), β-Tubulin rabbit pAb (Abclonal, cat# AC015), GAPDH mouse mAb (Cell Signaling Technology, cat# 2118), β -actin rabbit mAb (Cell Signaling Technology, cat# 4970), Alexa Fluor 488®-conjugated goat anti-rabbit IgG (H + L) (Invitrogen, cat# A-11008), HRP- (horseradish peroxidase-) conjugated goat anti-mouse IgG (Cell Signaling Technology, cat# 7076), and goat anti-rabbit IgG (Cell Signaling Technology, cat# 7074).

Techniques: Infection, Isolation, Protein Purification, Western Blot, Control

Localization of p-β-catenin(S552) and p-c-Jun (S73) in the absence or presence of BoHV-1 infection. MDBK cells were mock infected (A and C) or infected with BoHV-1 (MOI = 0.1) (B and D) for 24 h. After three washings with PBS, cells were fixed with 4% formaldehyde, and p-β-catenin(S552) and p-c-Jun (S73) were detected by IFA. Nuclei were stained with DAPI. Images were obtained by performing confocal microscopy. The images shown are representative of three independent experiments.

Journal: Veterinary Microbiology

Article Title: β-cantenin is potentially involved in the regulation of c-Jun signaling following bovine herpesvirus 1 infection

doi: 10.1016/j.vetmic.2020.108804

Figure Lengend Snippet: Localization of p-β-catenin(S552) and p-c-Jun (S73) in the absence or presence of BoHV-1 infection. MDBK cells were mock infected (A and C) or infected with BoHV-1 (MOI = 0.1) (B and D) for 24 h. After three washings with PBS, cells were fixed with 4% formaldehyde, and p-β-catenin(S552) and p-c-Jun (S73) were detected by IFA. Nuclei were stained with DAPI. Images were obtained by performing confocal microscopy. The images shown are representative of three independent experiments.

Article Snippet: The following antibodies were used in this study: phospho(p)-c-Jun (Ser73) rabbit monoclonal antibody (Cell Signaling Technology, cat# 3270), c-Jun rabbit mAb (Cell Signaling Technology, cat# 9165), p-JNK (Thr183/Tyr185) rabbit mAb (Cell Signaling Technology, cat# 9251), JNK rabbit polyclonal antibody (pAb) (Cell Signaling Technology, cat# 9252). p-β-catenin (Ser552) rabbit mAb (Cell Signaling Technology, cat# 9566). β-catenin (Ser552) rabbit mAb (Abcam, cat# ab32572), mouse control IgG (ABclonal, cat# AC011), rabbit control IgG (ABclonal, cat# AC005), laminA/C mouse mAb (Santa Cruz Biotechnology, cat# sc-376248), β-Tubulin rabbit pAb (Abclonal, cat# AC015), GAPDH mouse mAb (Cell Signaling Technology, cat# 2118), β -actin rabbit mAb (Cell Signaling Technology, cat# 4970), Alexa Fluor 488®-conjugated goat anti-rabbit IgG (H + L) (Invitrogen, cat# A-11008), HRP- (horseradish peroxidase-) conjugated goat anti-mouse IgG (Cell Signaling Technology, cat# 7076), and goat anti-rabbit IgG (Cell Signaling Technology, cat# 7074).

Techniques: Infection, Staining, Confocal Microscopy

BoHV-1 infection affected the association between β-catenin and c-Jun. MDBK cells in 60 mm dishes were mock infected or infected with BoHV-1(MOI = 0.1) for 24 h. Cell lysates were subjected to IP using antibody against β-catenin and c-Jun (A) or isotype IgG (B) as a control. Western blots were performed by using the antibodies indicated. Data shown are representative of two independent experiments.

Journal: Veterinary Microbiology

Article Title: β-cantenin is potentially involved in the regulation of c-Jun signaling following bovine herpesvirus 1 infection

doi: 10.1016/j.vetmic.2020.108804

Figure Lengend Snippet: BoHV-1 infection affected the association between β-catenin and c-Jun. MDBK cells in 60 mm dishes were mock infected or infected with BoHV-1(MOI = 0.1) for 24 h. Cell lysates were subjected to IP using antibody against β-catenin and c-Jun (A) or isotype IgG (B) as a control. Western blots were performed by using the antibodies indicated. Data shown are representative of two independent experiments.

Article Snippet: The following antibodies were used in this study: phospho(p)-c-Jun (Ser73) rabbit monoclonal antibody (Cell Signaling Technology, cat# 3270), c-Jun rabbit mAb (Cell Signaling Technology, cat# 9165), p-JNK (Thr183/Tyr185) rabbit mAb (Cell Signaling Technology, cat# 9251), JNK rabbit polyclonal antibody (pAb) (Cell Signaling Technology, cat# 9252). p-β-catenin (Ser552) rabbit mAb (Cell Signaling Technology, cat# 9566). β-catenin (Ser552) rabbit mAb (Abcam, cat# ab32572), mouse control IgG (ABclonal, cat# AC011), rabbit control IgG (ABclonal, cat# AC005), laminA/C mouse mAb (Santa Cruz Biotechnology, cat# sc-376248), β-Tubulin rabbit pAb (Abclonal, cat# AC015), GAPDH mouse mAb (Cell Signaling Technology, cat# 2118), β -actin rabbit mAb (Cell Signaling Technology, cat# 4970), Alexa Fluor 488®-conjugated goat anti-rabbit IgG (H + L) (Invitrogen, cat# A-11008), HRP- (horseradish peroxidase-) conjugated goat anti-mouse IgG (Cell Signaling Technology, cat# 7076), and goat anti-rabbit IgG (Cell Signaling Technology, cat# 7074).

Techniques: Infection, Control, Western Blot

BoHV-1 affected the association between β-catenin and c-Jun in the nucleus. MDBK cells in 60 mm dishes were mock infected or infected with BoHV-1 (MOI = 0.1) for 24 h. Nucleus proteins were purified using commercial nuclear protein purification kit (Beyotime Biotechnology, cat# P0027). IP was performed using antibodies against c-Jun. Then, Western blotting was performed using corresponding antibodies. Data shown are representative of two independent experiments.

Journal: Veterinary Microbiology

Article Title: β-cantenin is potentially involved in the regulation of c-Jun signaling following bovine herpesvirus 1 infection

doi: 10.1016/j.vetmic.2020.108804

Figure Lengend Snippet: BoHV-1 affected the association between β-catenin and c-Jun in the nucleus. MDBK cells in 60 mm dishes were mock infected or infected with BoHV-1 (MOI = 0.1) for 24 h. Nucleus proteins were purified using commercial nuclear protein purification kit (Beyotime Biotechnology, cat# P0027). IP was performed using antibodies against c-Jun. Then, Western blotting was performed using corresponding antibodies. Data shown are representative of two independent experiments.

Article Snippet: The following antibodies were used in this study: phospho(p)-c-Jun (Ser73) rabbit monoclonal antibody (Cell Signaling Technology, cat# 3270), c-Jun rabbit mAb (Cell Signaling Technology, cat# 9165), p-JNK (Thr183/Tyr185) rabbit mAb (Cell Signaling Technology, cat# 9251), JNK rabbit polyclonal antibody (pAb) (Cell Signaling Technology, cat# 9252). p-β-catenin (Ser552) rabbit mAb (Cell Signaling Technology, cat# 9566). β-catenin (Ser552) rabbit mAb (Abcam, cat# ab32572), mouse control IgG (ABclonal, cat# AC011), rabbit control IgG (ABclonal, cat# AC005), laminA/C mouse mAb (Santa Cruz Biotechnology, cat# sc-376248), β-Tubulin rabbit pAb (Abclonal, cat# AC015), GAPDH mouse mAb (Cell Signaling Technology, cat# 2118), β -actin rabbit mAb (Cell Signaling Technology, cat# 4970), Alexa Fluor 488®-conjugated goat anti-rabbit IgG (H + L) (Invitrogen, cat# A-11008), HRP- (horseradish peroxidase-) conjugated goat anti-mouse IgG (Cell Signaling Technology, cat# 7076), and goat anti-rabbit IgG (Cell Signaling Technology, cat# 7074).

Techniques: Infection, Purification, Protein Purification, Western Blot

The effects of β-catenin inhibitor iCRT14 on c-Jun signaling. MDBK cells in 60 mm dishes were pretreated with iCRT14 (10 u M) for 2 h, after which they were mock infected or infected with BoHV-1 at an MOI of 0.1 in the presence of iCRT14 (10 u M) or DMSO control. After infection for 24 h, cell lysates were prepared for Western blotting to detect the expression of c-Jun (A), p-c-Jun (S73)(B), and p-β-catenin(S552). (C), Cell morphology was observed under a light microscope. Images shown are representative of three independent experiments (Magnification ×200) (E). (D) The cytotoxicity of iCRT14 (10 u M) in MDBK cells for 24 h was analyzed by Trypan-blue exclusion test. Data shown are representative of three independent experiments.

Journal: Veterinary Microbiology

Article Title: β-cantenin is potentially involved in the regulation of c-Jun signaling following bovine herpesvirus 1 infection

doi: 10.1016/j.vetmic.2020.108804

Figure Lengend Snippet: The effects of β-catenin inhibitor iCRT14 on c-Jun signaling. MDBK cells in 60 mm dishes were pretreated with iCRT14 (10 u M) for 2 h, after which they were mock infected or infected with BoHV-1 at an MOI of 0.1 in the presence of iCRT14 (10 u M) or DMSO control. After infection for 24 h, cell lysates were prepared for Western blotting to detect the expression of c-Jun (A), p-c-Jun (S73)(B), and p-β-catenin(S552). (C), Cell morphology was observed under a light microscope. Images shown are representative of three independent experiments (Magnification ×200) (E). (D) The cytotoxicity of iCRT14 (10 u M) in MDBK cells for 24 h was analyzed by Trypan-blue exclusion test. Data shown are representative of three independent experiments.

Article Snippet: The following antibodies were used in this study: phospho(p)-c-Jun (Ser73) rabbit monoclonal antibody (Cell Signaling Technology, cat# 3270), c-Jun rabbit mAb (Cell Signaling Technology, cat# 9165), p-JNK (Thr183/Tyr185) rabbit mAb (Cell Signaling Technology, cat# 9251), JNK rabbit polyclonal antibody (pAb) (Cell Signaling Technology, cat# 9252). p-β-catenin (Ser552) rabbit mAb (Cell Signaling Technology, cat# 9566). β-catenin (Ser552) rabbit mAb (Abcam, cat# ab32572), mouse control IgG (ABclonal, cat# AC011), rabbit control IgG (ABclonal, cat# AC005), laminA/C mouse mAb (Santa Cruz Biotechnology, cat# sc-376248), β-Tubulin rabbit pAb (Abclonal, cat# AC015), GAPDH mouse mAb (Cell Signaling Technology, cat# 2118), β -actin rabbit mAb (Cell Signaling Technology, cat# 4970), Alexa Fluor 488®-conjugated goat anti-rabbit IgG (H + L) (Invitrogen, cat# A-11008), HRP- (horseradish peroxidase-) conjugated goat anti-mouse IgG (Cell Signaling Technology, cat# 7076), and goat anti-rabbit IgG (Cell Signaling Technology, cat# 7074).

Techniques: Infection, Control, Western Blot, Expressing, Light Microscopy

The effects of β-catenin inhibitor iCRT14 on JNK signaling. MDBK cells in 60 mm dishes were pretreated with iCRT14 (10 u M) for 2 h, after which they were mock infected or infected with BoHV-1 at an MOI of 0.1 in the presence of iCRT14 (10 u M) or DMSO control. After infection for 24 h, the cell lysates were prepared for Western blotting to detect the expression of JNK (A) and p-JNK(Thr183/Tyr185) (B). MDBK cells in 60 mm dishes were pretreated with either iCRT14 (10 u M) or SP600125 (25 u M) for 2 h, after which they were mock infected or infected with BoHV-1 at an MOI of 0.1 in the presence of indicated inhibitors or DMSO control. After infection for 24 h the cell lysates were prepared to detect both p-JNK(Thr183/Tyr185) (C) and p-c-Jun(S73) (D), respectively. (E) The cytotoxicity of SP600125 (25 u M) in MDBK cells for 24 h was analyzed by Trypan-blue exclusion test. (F) After a pretreatment for 2 h with SP600125 (25 u M), MDBK cells were mock infected or infected with BoHV-1(MOI = 0.1) in the presence of either SP600125 or DMSO control for 24 h, and cell morphology was observed under a light microscope. Magnification ×200. Data shown are representative of three independent experiments.

Journal: Veterinary Microbiology

Article Title: β-cantenin is potentially involved in the regulation of c-Jun signaling following bovine herpesvirus 1 infection

doi: 10.1016/j.vetmic.2020.108804

Figure Lengend Snippet: The effects of β-catenin inhibitor iCRT14 on JNK signaling. MDBK cells in 60 mm dishes were pretreated with iCRT14 (10 u M) for 2 h, after which they were mock infected or infected with BoHV-1 at an MOI of 0.1 in the presence of iCRT14 (10 u M) or DMSO control. After infection for 24 h, the cell lysates were prepared for Western blotting to detect the expression of JNK (A) and p-JNK(Thr183/Tyr185) (B). MDBK cells in 60 mm dishes were pretreated with either iCRT14 (10 u M) or SP600125 (25 u M) for 2 h, after which they were mock infected or infected with BoHV-1 at an MOI of 0.1 in the presence of indicated inhibitors or DMSO control. After infection for 24 h the cell lysates were prepared to detect both p-JNK(Thr183/Tyr185) (C) and p-c-Jun(S73) (D), respectively. (E) The cytotoxicity of SP600125 (25 u M) in MDBK cells for 24 h was analyzed by Trypan-blue exclusion test. (F) After a pretreatment for 2 h with SP600125 (25 u M), MDBK cells were mock infected or infected with BoHV-1(MOI = 0.1) in the presence of either SP600125 or DMSO control for 24 h, and cell morphology was observed under a light microscope. Magnification ×200. Data shown are representative of three independent experiments.

Article Snippet: The following antibodies were used in this study: phospho(p)-c-Jun (Ser73) rabbit monoclonal antibody (Cell Signaling Technology, cat# 3270), c-Jun rabbit mAb (Cell Signaling Technology, cat# 9165), p-JNK (Thr183/Tyr185) rabbit mAb (Cell Signaling Technology, cat# 9251), JNK rabbit polyclonal antibody (pAb) (Cell Signaling Technology, cat# 9252). p-β-catenin (Ser552) rabbit mAb (Cell Signaling Technology, cat# 9566). β-catenin (Ser552) rabbit mAb (Abcam, cat# ab32572), mouse control IgG (ABclonal, cat# AC011), rabbit control IgG (ABclonal, cat# AC005), laminA/C mouse mAb (Santa Cruz Biotechnology, cat# sc-376248), β-Tubulin rabbit pAb (Abclonal, cat# AC015), GAPDH mouse mAb (Cell Signaling Technology, cat# 2118), β -actin rabbit mAb (Cell Signaling Technology, cat# 4970), Alexa Fluor 488®-conjugated goat anti-rabbit IgG (H + L) (Invitrogen, cat# A-11008), HRP- (horseradish peroxidase-) conjugated goat anti-mouse IgG (Cell Signaling Technology, cat# 7076), and goat anti-rabbit IgG (Cell Signaling Technology, cat# 7074).

Techniques: Infection, Control, Western Blot, Expressing, Light Microscopy

Immunofluorescence staining of phospho-β-catenin (p-β-catenin, Ser 675) in mouse kidneys was performed to determine the state of phosphorus metabolism . Immunofluorescence staining of p-β-catenin at Ser675 in mouse renal tissue sections. p-β-catenin was detected using an Alexa Fluor 555-conjugated antibody ( red ); the proximal tubular marker LTL was labeled with FITC ( green ), and nuclei were counterstained with DAPI ( blue ) (N = 6). This scale bar represents 100 μm. Data were acquired using a confocal laser scanning microscope. LTL, Lotus tetragonolobus lectin.

Journal: The Journal of Biological Chemistry

Article Title: PKM2 inhibitor suppresses kidney fibrogenesis by disrupting YAP-TEAD-CCN2 transcriptional signaling following ischemia–reperfusion injury

doi: 10.1016/j.jbc.2025.111029

Figure Lengend Snippet: Immunofluorescence staining of phospho-β-catenin (p-β-catenin, Ser 675) in mouse kidneys was performed to determine the state of phosphorus metabolism . Immunofluorescence staining of p-β-catenin at Ser675 in mouse renal tissue sections. p-β-catenin was detected using an Alexa Fluor 555-conjugated antibody ( red ); the proximal tubular marker LTL was labeled with FITC ( green ), and nuclei were counterstained with DAPI ( blue ) (N = 6). This scale bar represents 100 μm. Data were acquired using a confocal laser scanning microscope. LTL, Lotus tetragonolobus lectin.

Article Snippet: To detect YAP1 (rabbit anti-YAP1, 750 μg/ml #13584-1-AP; Proteintech) and p-β-catenin (Ser552: rabbit anti-p-β-catenin, 50 μg/ml #4176, CST; Ser675: rabbit anti-p-β-catenin, 310 μg/ml #5651, CST), tissue sections were incubated with primary antibodies diluted in blocking buffer (1% BSA/PBS) at 4 °C for 24 h (YAP1: 1:300; p-β-catenin: 1:100).

Techniques: Immunofluorescence, Staining, Marker, Labeling, Laser-Scanning Microscopy

Immunofluorescence staining of p-β-catenin (Ser552) in mouse kidneys was performed to determine the state of phosphorus metabolism . Immunofluorescence staining of p-β-catenin at Ser552 in mouse renal tissue sections. p-β-catenin was detected using an Alexa Fluor 555-conjugated antibody ( red ); the proximal tubular marker LTL was labeled with FITC ( green ), and nuclei were counterstained with DAPI ( blue ) (N = 6). This scale bar represents 100 μm. Data were acquired using a confocal laser scanning microscope. LTL, Lotus tetragonolobus lectin.

Journal: The Journal of Biological Chemistry

Article Title: PKM2 inhibitor suppresses kidney fibrogenesis by disrupting YAP-TEAD-CCN2 transcriptional signaling following ischemia–reperfusion injury

doi: 10.1016/j.jbc.2025.111029

Figure Lengend Snippet: Immunofluorescence staining of p-β-catenin (Ser552) in mouse kidneys was performed to determine the state of phosphorus metabolism . Immunofluorescence staining of p-β-catenin at Ser552 in mouse renal tissue sections. p-β-catenin was detected using an Alexa Fluor 555-conjugated antibody ( red ); the proximal tubular marker LTL was labeled with FITC ( green ), and nuclei were counterstained with DAPI ( blue ) (N = 6). This scale bar represents 100 μm. Data were acquired using a confocal laser scanning microscope. LTL, Lotus tetragonolobus lectin.

Article Snippet: To detect YAP1 (rabbit anti-YAP1, 750 μg/ml #13584-1-AP; Proteintech) and p-β-catenin (Ser552: rabbit anti-p-β-catenin, 50 μg/ml #4176, CST; Ser675: rabbit anti-p-β-catenin, 310 μg/ml #5651, CST), tissue sections were incubated with primary antibodies diluted in blocking buffer (1% BSA/PBS) at 4 °C for 24 h (YAP1: 1:300; p-β-catenin: 1:100).

Techniques: Immunofluorescence, Staining, Marker, Labeling, Laser-Scanning Microscopy

Western blot analysis of cell fraction protein expression in 3k-treated and siPKM2-transfected HK-2 cells . A and B , Western blot analysis of cytoplasmic and nuclear protein fractions from 3k-treated HK-2 cells to determine β-catenin and YAP1 nuclear translocation. C and D , western blot analysis of cytoplasmic and nuclear protein fractions from siPKM2-transfected HK-2 cells to determine β-catenin and YAP1 nuclear translocation (N = 6).

Journal: The Journal of Biological Chemistry

Article Title: PKM2 inhibitor suppresses kidney fibrogenesis by disrupting YAP-TEAD-CCN2 transcriptional signaling following ischemia–reperfusion injury

doi: 10.1016/j.jbc.2025.111029

Figure Lengend Snippet: Western blot analysis of cell fraction protein expression in 3k-treated and siPKM2-transfected HK-2 cells . A and B , Western blot analysis of cytoplasmic and nuclear protein fractions from 3k-treated HK-2 cells to determine β-catenin and YAP1 nuclear translocation. C and D , western blot analysis of cytoplasmic and nuclear protein fractions from siPKM2-transfected HK-2 cells to determine β-catenin and YAP1 nuclear translocation (N = 6).

Article Snippet: To detect YAP1 (rabbit anti-YAP1, 750 μg/ml #13584-1-AP; Proteintech) and p-β-catenin (Ser552: rabbit anti-p-β-catenin, 50 μg/ml #4176, CST; Ser675: rabbit anti-p-β-catenin, 310 μg/ml #5651, CST), tissue sections were incubated with primary antibodies diluted in blocking buffer (1% BSA/PBS) at 4 °C for 24 h (YAP1: 1:300; p-β-catenin: 1:100).

Techniques: Western Blot, Expressing, Transfection, Translocation Assay

Western blot analysis of cross-linked protein expression and Co-IP analysis in HK-2 cells . A , western blot analysis of cross-linked proteins extracted from 3k-treated HK-2 cells. B and C , Co-IP analysis of the interaction between YAP1, β-catenin, and PKM2 in HK-2 cells. IP was performed using protein samples from HK-2 cells overexpressing CCN2. Co-IP with an anti-PKM2 antibody confirmed that both β-catenin and YAP1 co-precipitated with PKM2 (N = 6), ( D ) as illustrated in the schematic diagram. CCN2, cellular communication network factor 2.

Journal: The Journal of Biological Chemistry

Article Title: PKM2 inhibitor suppresses kidney fibrogenesis by disrupting YAP-TEAD-CCN2 transcriptional signaling following ischemia–reperfusion injury

doi: 10.1016/j.jbc.2025.111029

Figure Lengend Snippet: Western blot analysis of cross-linked protein expression and Co-IP analysis in HK-2 cells . A , western blot analysis of cross-linked proteins extracted from 3k-treated HK-2 cells. B and C , Co-IP analysis of the interaction between YAP1, β-catenin, and PKM2 in HK-2 cells. IP was performed using protein samples from HK-2 cells overexpressing CCN2. Co-IP with an anti-PKM2 antibody confirmed that both β-catenin and YAP1 co-precipitated with PKM2 (N = 6), ( D ) as illustrated in the schematic diagram. CCN2, cellular communication network factor 2.

Article Snippet: To detect YAP1 (rabbit anti-YAP1, 750 μg/ml #13584-1-AP; Proteintech) and p-β-catenin (Ser552: rabbit anti-p-β-catenin, 50 μg/ml #4176, CST; Ser675: rabbit anti-p-β-catenin, 310 μg/ml #5651, CST), tissue sections were incubated with primary antibodies diluted in blocking buffer (1% BSA/PBS) at 4 °C for 24 h (YAP1: 1:300; p-β-catenin: 1:100).

Techniques: Western Blot, Expressing, Co-Immunoprecipitation Assay

CEMM disruption promotes autophagic flux (A) HeLa cells were pre-treated with MBCD at the indicated concentration for 1 h, then incubated in the presence or absence of bafilomycin A1 (Baf A1, 100 nM) for 2 h. Cell lysates were collected and subjected to western blots for the indicated markers. (B) HeLa cells were pre-treated with or without MBCD (5 mM) for 1 h, then incubated in the presence or absence of Baf A1 (100 nM) for the indicated times. Cell lysates were collected and subjected to western blots for the indicated markers. (C) HeLa cells were pre-treated with or without MBCD (5 mM) for 1 h, then incubated in the presence or absence of cholesterol (CHO, 30 μg/mL) or Baf A1 (100 nM) as indicated for 2 h. Cell lysates were collected and subjected to western blots for the indicated markers. (D) HeLa cells with stable expression of GFP-LC3B were pre-treated with or without MBCD (5 mM) for 1 h, then incubated in the presence or absence of amino acid-deficient DMEM medium (AA–), CHO (30 μg/mL), or Baf A1 (100 nM) as indicated. The cells were observed under a confocal microscope (×600). Scale bars, 5 μm. (E) The number of GFP-LC3B puncta observed in (D) are presented as means ± SD. Statistical significance was evaluated using a two-tailed Student's t test. ∗∗∗∗p < 0.0001. (F) Cav1 WT and c av1 KO MEFs were treated with or without Baf A1 (100 nM) for 2 h. The total cell lysates were then immunoblotted with the indicated markers. (G) In the presence or absence of genistein (200 μM), HeLa cells were pre-treated with MBCD (5 mM, 1 h) and then incubated with BSA-Alexa 488 (50 μg/mL). (H) In the presence or absence of genistein (200 μM), Cav1 WT and cav1 KO MEFs were incubated with BSA-Alexa 488 (50 μg/mL). Cells were observed under a confocal microscope. (I) The intracellular uptake of BSA-Alexa 488 (the fluorescence signals inside the cytoplasm) in (G) were analyzed using ImageJ (normalized to control [Ctrl] cells). ∗∗∗∗p < 0.0001. (J) The intracellular uptake of BSA-Alexa 488 (the fluorescence signals inside the cytoplasm) in (H) were analyzed using ImageJ (normalized to WT cells). Statistical significance was evaluated with a two-tailed Student's t test. ∗∗∗∗p < 0.0001. (K) HeLa cells were pre-treated with or without MBCD (5 mM) for 1 h, then incubated in the presence or absence of genistein (200 μM) or Baf A1 (100 nM) as indicated for 2 h. (L) Cav1 WT and cav1 KO MEFs were treated in the presence or absence of genistein (200 μM) or Baf A1 (100 nM) as indicated for 2 h. The total cell lysates were then immunoblotted with the indicated markers.

Journal: Molecular Therapy Oncolytics

Article Title: Cholesterol-enriched membrane micro-domaindeficiency induces doxorubicin resistancevia promoting autophagy in breast cancer

doi: 10.1016/j.omto.2021.10.005

Figure Lengend Snippet: CEMM disruption promotes autophagic flux (A) HeLa cells were pre-treated with MBCD at the indicated concentration for 1 h, then incubated in the presence or absence of bafilomycin A1 (Baf A1, 100 nM) for 2 h. Cell lysates were collected and subjected to western blots for the indicated markers. (B) HeLa cells were pre-treated with or without MBCD (5 mM) for 1 h, then incubated in the presence or absence of Baf A1 (100 nM) for the indicated times. Cell lysates were collected and subjected to western blots for the indicated markers. (C) HeLa cells were pre-treated with or without MBCD (5 mM) for 1 h, then incubated in the presence or absence of cholesterol (CHO, 30 μg/mL) or Baf A1 (100 nM) as indicated for 2 h. Cell lysates were collected and subjected to western blots for the indicated markers. (D) HeLa cells with stable expression of GFP-LC3B were pre-treated with or without MBCD (5 mM) for 1 h, then incubated in the presence or absence of amino acid-deficient DMEM medium (AA–), CHO (30 μg/mL), or Baf A1 (100 nM) as indicated. The cells were observed under a confocal microscope (×600). Scale bars, 5 μm. (E) The number of GFP-LC3B puncta observed in (D) are presented as means ± SD. Statistical significance was evaluated using a two-tailed Student's t test. ∗∗∗∗p < 0.0001. (F) Cav1 WT and c av1 KO MEFs were treated with or without Baf A1 (100 nM) for 2 h. The total cell lysates were then immunoblotted with the indicated markers. (G) In the presence or absence of genistein (200 μM), HeLa cells were pre-treated with MBCD (5 mM, 1 h) and then incubated with BSA-Alexa 488 (50 μg/mL). (H) In the presence or absence of genistein (200 μM), Cav1 WT and cav1 KO MEFs were incubated with BSA-Alexa 488 (50 μg/mL). Cells were observed under a confocal microscope. (I) The intracellular uptake of BSA-Alexa 488 (the fluorescence signals inside the cytoplasm) in (G) were analyzed using ImageJ (normalized to control [Ctrl] cells). ∗∗∗∗p < 0.0001. (J) The intracellular uptake of BSA-Alexa 488 (the fluorescence signals inside the cytoplasm) in (H) were analyzed using ImageJ (normalized to WT cells). Statistical significance was evaluated with a two-tailed Student's t test. ∗∗∗∗p < 0.0001. (K) HeLa cells were pre-treated with or without MBCD (5 mM) for 1 h, then incubated in the presence or absence of genistein (200 μM) or Baf A1 (100 nM) as indicated for 2 h. (L) Cav1 WT and cav1 KO MEFs were treated in the presence or absence of genistein (200 μM) or Baf A1 (100 nM) as indicated for 2 h. The total cell lysates were then immunoblotted with the indicated markers.

Article Snippet: The chemicals used in this study were: MBCD (Sigma, C4555), cholesterol-water soluble (Sigma, C4951), Baf A1 (Santa Cruz, CAS 88899-55-2), Wort (Santa Cruz, CAS 19545-26-7), cholera toxin subunit B conjugated with Alexa Fluor 594 (CTxB, Invitrogen, C34777), DAB (Dako, K401011), NEM (Sigma, E3876), DTT (Sigma, D9779), human transferrin peroxidase (Rockland antibodies and assays, 009-0334).

Techniques: Disruption, Concentration Assay, Incubation, Western Blot, Expressing, Microscopy, Two Tailed Test, Fluorescence, Control

CEMM disruption promotes autophagosome biogenesis (A) Electron micrographs of HeLa cells treated as the (1) Ctrl; (2) MBCD 5mM, pre-treated 1 h, then incubated for 2 h; (3) MBCD pre-treated as described in (2), then the cells were incubated with CHO (30 μg/mL) for 2 h; (4) cells were treated in AA for 2 h as positive control. Scale bars, 0.5 μm. (B) Cav1 WT and c av1 KO MEFs were treated with or without wortmannin (Wort, 100 nM) for 2 h. Cells were immunostained by ATG16L1 or WIPI2, and observed under confocal microscope (×600). Scale bars, 5 μm. (C) The number of WIPI2 puncta observed in (B) are presented as means ± SD. ∗∗∗∗p < 0.0001; NS > 0.05. (D) The number of ATG16L1 puncta observed in (B) are presented as means ± SD. ∗∗∗∗p < 0.0001; NS > 0.05. (E) HeLa cells were pre-treated with or without MBCD (5 mM) for 1 h, then incubated in the presence or absence of CHO (30 μg/mL) or Wort (100 nM) as indicated for 2 h. Cells were immunostained by ATG16L1 or WIPI2, and observed under a confocal microscope (×600). Scale bars, 5 μm. (F) The number of WIPI2 puncta observed in (E) are presented as means ± SD. ∗∗∗∗p < 0.0001. (G) The number of ATG16L1 puncta observed in (E) are presented as means ± SD. ∗∗∗∗p < 0.0001. (H) HeLa cells with stable expression of GFP-LC3B were pre-treated with or without MBCD (5 mM) for 1 h, then incubated in the presence or absence of CHO (30 μg/mL) for 2 h, meanwhile Baf A1 (100 nM) was added to all the treatments to induce enough accumulation of autophagic vesicles for observing colocalization between ATG16L1 and GFP-LC3. All the cells were immunostained by ATG16L1. Scale bars, 5 μm. (I) The Pearson correlation coefficient of GFP-LC3B puncta with ATG16L1 from the experiment described in (H). ∗∗∗∗p < 0.0001. (J) HeLa cells with stable expression of GFP-LC3B were treated as described in (H), then immunostained by WIPI2. Scale bars, 5 μm. (K) The Pearson correlation coefficient of GFP-LC3B puncta with WIPI2 from the experiment described in (J). ∗∗∗∗p < 0.0001.

Journal: Molecular Therapy Oncolytics

Article Title: Cholesterol-enriched membrane micro-domaindeficiency induces doxorubicin resistancevia promoting autophagy in breast cancer

doi: 10.1016/j.omto.2021.10.005

Figure Lengend Snippet: CEMM disruption promotes autophagosome biogenesis (A) Electron micrographs of HeLa cells treated as the (1) Ctrl; (2) MBCD 5mM, pre-treated 1 h, then incubated for 2 h; (3) MBCD pre-treated as described in (2), then the cells were incubated with CHO (30 μg/mL) for 2 h; (4) cells were treated in AA for 2 h as positive control. Scale bars, 0.5 μm. (B) Cav1 WT and c av1 KO MEFs were treated with or without wortmannin (Wort, 100 nM) for 2 h. Cells were immunostained by ATG16L1 or WIPI2, and observed under confocal microscope (×600). Scale bars, 5 μm. (C) The number of WIPI2 puncta observed in (B) are presented as means ± SD. ∗∗∗∗p < 0.0001; NS > 0.05. (D) The number of ATG16L1 puncta observed in (B) are presented as means ± SD. ∗∗∗∗p < 0.0001; NS > 0.05. (E) HeLa cells were pre-treated with or without MBCD (5 mM) for 1 h, then incubated in the presence or absence of CHO (30 μg/mL) or Wort (100 nM) as indicated for 2 h. Cells were immunostained by ATG16L1 or WIPI2, and observed under a confocal microscope (×600). Scale bars, 5 μm. (F) The number of WIPI2 puncta observed in (E) are presented as means ± SD. ∗∗∗∗p < 0.0001. (G) The number of ATG16L1 puncta observed in (E) are presented as means ± SD. ∗∗∗∗p < 0.0001. (H) HeLa cells with stable expression of GFP-LC3B were pre-treated with or without MBCD (5 mM) for 1 h, then incubated in the presence or absence of CHO (30 μg/mL) for 2 h, meanwhile Baf A1 (100 nM) was added to all the treatments to induce enough accumulation of autophagic vesicles for observing colocalization between ATG16L1 and GFP-LC3. All the cells were immunostained by ATG16L1. Scale bars, 5 μm. (I) The Pearson correlation coefficient of GFP-LC3B puncta with ATG16L1 from the experiment described in (H). ∗∗∗∗p < 0.0001. (J) HeLa cells with stable expression of GFP-LC3B were treated as described in (H), then immunostained by WIPI2. Scale bars, 5 μm. (K) The Pearson correlation coefficient of GFP-LC3B puncta with WIPI2 from the experiment described in (J). ∗∗∗∗p < 0.0001.

Article Snippet: The chemicals used in this study were: MBCD (Sigma, C4555), cholesterol-water soluble (Sigma, C4951), Baf A1 (Santa Cruz, CAS 88899-55-2), Wort (Santa Cruz, CAS 19545-26-7), cholera toxin subunit B conjugated with Alexa Fluor 594 (CTxB, Invitrogen, C34777), DAB (Dako, K401011), NEM (Sigma, E3876), DTT (Sigma, D9779), human transferrin peroxidase (Rockland antibodies and assays, 009-0334).

Techniques: Disruption, Incubation, Positive Control, Microscopy, Expressing

CEMM disruption releases VAMP3 from CEMMs at recycling endosomal membrane (A) After ablation of recycling endosomes, HeLa cells were immunostained with Rab11 (red), and observed under a confocal microscope (×600). Scale bars, 5 μm. (B) After ablation of recycling endosome, HeLa cells with stable expression of GFP-LC3B were pre-treated with MBCD (5 mM, 1 h) and then incubated in the presence or absence of Baf A1 (100 nM). Then cells were observed under a confocal microscope (×600). Scale bars, 5 μm. (C) The number of GFP-LC3 puncta observed in (B) are presented as means ± SD. ∗∗∗∗p < 0.0001. (D) HeLa cells were pre-treated with MBCD (5 mM, 1 h) and then incubated in the presence or absence of CHO (30 μg/mL) at 37°C or 18°C. Cells were immunostained by RAB11 (green) and VAMP3 (red). Scale bars, 5 μm. (E) The Pearson correlation coefficient of RAB11 and VAMP3 from the experiment described in (D) was summarized to represent the colocalization efficiency. ∗∗p < 0.01. (F) HeLa cells were pre-treated with MBCD (5 mM, 1 h) and then incubated in the presence or absence of CHO (30 μg/mL). Then cells were stained with Filipin (excitation, 365 nm; emission, 397 nm; false colored green) and then immunostained by VAMP3 (red). Scale bars, 5 μm. (G) The Pearson correlation coefficient of Filipin with VAMP3 from the experiment described in (F) was summarized to represent the colocalization efficiency. ∗∗p < 0.01. (H) HeLa cells were treated as described in (F). Then cells were stained with CTxB (red) and then immunostained by VAMP3 (green). Scale bars, 5 μm. (I) The Pearson correlation coefficient of CTxB with VAMP3 from the experiment described in (H) was summarized to represent the colocalization efficiency. ∗∗p < 0.01. (J) HeLa cells were treated as described in (F). Then cells were fractioned into a detergent soluble fraction (DSF) and a detergent-resistant fraction (DRF). Both lysates were separated and immunoblotted with the indicated markers.

Journal: Molecular Therapy Oncolytics

Article Title: Cholesterol-enriched membrane micro-domaindeficiency induces doxorubicin resistancevia promoting autophagy in breast cancer

doi: 10.1016/j.omto.2021.10.005

Figure Lengend Snippet: CEMM disruption releases VAMP3 from CEMMs at recycling endosomal membrane (A) After ablation of recycling endosomes, HeLa cells were immunostained with Rab11 (red), and observed under a confocal microscope (×600). Scale bars, 5 μm. (B) After ablation of recycling endosome, HeLa cells with stable expression of GFP-LC3B were pre-treated with MBCD (5 mM, 1 h) and then incubated in the presence or absence of Baf A1 (100 nM). Then cells were observed under a confocal microscope (×600). Scale bars, 5 μm. (C) The number of GFP-LC3 puncta observed in (B) are presented as means ± SD. ∗∗∗∗p < 0.0001. (D) HeLa cells were pre-treated with MBCD (5 mM, 1 h) and then incubated in the presence or absence of CHO (30 μg/mL) at 37°C or 18°C. Cells were immunostained by RAB11 (green) and VAMP3 (red). Scale bars, 5 μm. (E) The Pearson correlation coefficient of RAB11 and VAMP3 from the experiment described in (D) was summarized to represent the colocalization efficiency. ∗∗p < 0.01. (F) HeLa cells were pre-treated with MBCD (5 mM, 1 h) and then incubated in the presence or absence of CHO (30 μg/mL). Then cells were stained with Filipin (excitation, 365 nm; emission, 397 nm; false colored green) and then immunostained by VAMP3 (red). Scale bars, 5 μm. (G) The Pearson correlation coefficient of Filipin with VAMP3 from the experiment described in (F) was summarized to represent the colocalization efficiency. ∗∗p < 0.01. (H) HeLa cells were treated as described in (F). Then cells were stained with CTxB (red) and then immunostained by VAMP3 (green). Scale bars, 5 μm. (I) The Pearson correlation coefficient of CTxB with VAMP3 from the experiment described in (H) was summarized to represent the colocalization efficiency. ∗∗p < 0.01. (J) HeLa cells were treated as described in (F). Then cells were fractioned into a detergent soluble fraction (DSF) and a detergent-resistant fraction (DRF). Both lysates were separated and immunoblotted with the indicated markers.

Article Snippet: The chemicals used in this study were: MBCD (Sigma, C4555), cholesterol-water soluble (Sigma, C4951), Baf A1 (Santa Cruz, CAS 88899-55-2), Wort (Santa Cruz, CAS 19545-26-7), cholera toxin subunit B conjugated with Alexa Fluor 594 (CTxB, Invitrogen, C34777), DAB (Dako, K401011), NEM (Sigma, E3876), DTT (Sigma, D9779), human transferrin peroxidase (Rockland antibodies and assays, 009-0334).

Techniques: Disruption, Membrane, Microscopy, Expressing, Incubation, Staining

Inhibition of VAMP3 activity decreases autophagosome biogenesis induced by CEMM disruption (A) HeLa cells were pre-treated with 100 μM N-ethylmaleimide (NEM) in the absence or presence of 200 μM dithiothreitol (DTT) on ice for 30 min. Then the cells were incubated with normal medium or medium containing MBCD (5 mM) for 1 h and following treatments as indicated for 2 h, cell lysates were collected and subjected to western blots for the indicated markers. (B) HeLa cells with stable expression of GFP-LC3 were transfected with scrambled siRNA or VAMP3 siRNAs (si VAMP3 ) for 24 h. Then cells were pre-treated with MBCD (5 mM) for 1 h, and following incubated with or without CQ (50 μM) for 2 h. GFP-LC3 puncta were observed under a confocal microscope (×600). Scale bars, 5 μm. (C) The number of GFP-LC3B puncta observed in (B) are presented as means ± SD. ∗∗∗∗p < 0.0001; NS > 0.05. (D) HeLa cells with the same treatments as described in (B) were harvested and examined by western blots. (E) HeLa cells were transfected with scrambled siRNA or VAMP3 siRNAs (si VAMP3 ) for 24 h. Then the cells were transfected with EGFP or EGFP-VAMP3 to rescue VAMP3 expression. The cells were pre-treated by MBCD (5 mM) for 1 h, and subsequently incubated with or without Baf A1 (100 nM) for 2 h. The cell lysates were collected and subjected to western blots for the indicated markers.

Journal: Molecular Therapy Oncolytics

Article Title: Cholesterol-enriched membrane micro-domaindeficiency induces doxorubicin resistancevia promoting autophagy in breast cancer

doi: 10.1016/j.omto.2021.10.005

Figure Lengend Snippet: Inhibition of VAMP3 activity decreases autophagosome biogenesis induced by CEMM disruption (A) HeLa cells were pre-treated with 100 μM N-ethylmaleimide (NEM) in the absence or presence of 200 μM dithiothreitol (DTT) on ice for 30 min. Then the cells were incubated with normal medium or medium containing MBCD (5 mM) for 1 h and following treatments as indicated for 2 h, cell lysates were collected and subjected to western blots for the indicated markers. (B) HeLa cells with stable expression of GFP-LC3 were transfected with scrambled siRNA or VAMP3 siRNAs (si VAMP3 ) for 24 h. Then cells were pre-treated with MBCD (5 mM) for 1 h, and following incubated with or without CQ (50 μM) for 2 h. GFP-LC3 puncta were observed under a confocal microscope (×600). Scale bars, 5 μm. (C) The number of GFP-LC3B puncta observed in (B) are presented as means ± SD. ∗∗∗∗p < 0.0001; NS > 0.05. (D) HeLa cells with the same treatments as described in (B) were harvested and examined by western blots. (E) HeLa cells were transfected with scrambled siRNA or VAMP3 siRNAs (si VAMP3 ) for 24 h. Then the cells were transfected with EGFP or EGFP-VAMP3 to rescue VAMP3 expression. The cells were pre-treated by MBCD (5 mM) for 1 h, and subsequently incubated with or without Baf A1 (100 nM) for 2 h. The cell lysates were collected and subjected to western blots for the indicated markers.

Article Snippet: The chemicals used in this study were: MBCD (Sigma, C4555), cholesterol-water soluble (Sigma, C4951), Baf A1 (Santa Cruz, CAS 88899-55-2), Wort (Santa Cruz, CAS 19545-26-7), cholera toxin subunit B conjugated with Alexa Fluor 594 (CTxB, Invitrogen, C34777), DAB (Dako, K401011), NEM (Sigma, E3876), DTT (Sigma, D9779), human transferrin peroxidase (Rockland antibodies and assays, 009-0334).

Techniques: Inhibition, Activity Assay, Disruption, Incubation, Western Blot, Expressing, Transfection, Microscopy

CEMM deficiency-induced autophagy is associated with the acquisition of Doxo resistance in breast cancer cells (A) The expression levels of CAV1 were detected from the TCGA databases in different types of tumor samples and paired normal tissues. Red bars, tumor samples; blue bars, normal samples. ∗∗∗∗p < 0.0001. (B). CAV1 expression in mammary epithelial cell lines MCF10A and seven different breast cancer cell lines. (C) Dox-on shCtrl and sh CAV1 MDA-MB-231 cells in the presence of Dox in culture medium were treated with or without Baf A1 (100 nM) as indicated for 2 h. Then cells were collected and immunoblotted with the indicated markers. (D) The sulforhodamine cytotoxicity assay to evaluate Doxo in shCtrl and sh CAV1 MDA-MB-231 cells. shCtrl and sh CAV1 MDA-MB-231 cells were treated with an increasing concentration of Doxo for determination of growth inhibitory IC 50 values. The data were normalized against 100% survival at the lowest inhibitor concentration. Graphs for IC 50 were fitted to the four-parameter logistic equation using Prism8 and shown in the table. Error bars show the percent coefficient of variation. (E) shCtrl and sh CAV1 MDA-MB-231 cells were treated with Doxo (5 μM), HCQ (100 μM), or their combination for 48 h. After treatments, cells were collected and stained with PI and annexin V and then subjected to flow cytometry. (F) Statistical analysis of experiments described in (E) are presented. ∗∗∗p < 0.001; NS > 0.05. (G) shCtrl and sh CAV1 MDA-MB-231 cells were treated as described in (E). Then cells were collected and examined with the indicated markers by western blots. (H) Colony formation assay for the shCtrl and sh CAV1 MDA-MB-231 cells treated as indicated for 48 h. (I) Statistical analysis of experiments described in (H) are presented. ∗∗∗p < 0.001; NS > 0.05. (J) Dox-on shCtrl and sh CAV1 MDA-MB-231 cells were incubated in the presence Dox in culture medium. After transfection with ATG7 siRNA (si ATG7 ) or scrambled siRNA for 48 h, cells were treated with Doxo (5 μM), HCQ (100 μM), or their combination for 48 h. Then cells were stained with PI (red) and observed under a fluoresce microscope. The stable shCtrl and sh CAV1 MDA-MB-231 cells expressed GFP protein when the Dox-on element is activated. Statistical analysis of observed percentage of PI-positive cells is presented. ∗∗p < 0.01; NS > 0.05.

Journal: Molecular Therapy Oncolytics

Article Title: Cholesterol-enriched membrane micro-domaindeficiency induces doxorubicin resistancevia promoting autophagy in breast cancer

doi: 10.1016/j.omto.2021.10.005

Figure Lengend Snippet: CEMM deficiency-induced autophagy is associated with the acquisition of Doxo resistance in breast cancer cells (A) The expression levels of CAV1 were detected from the TCGA databases in different types of tumor samples and paired normal tissues. Red bars, tumor samples; blue bars, normal samples. ∗∗∗∗p < 0.0001. (B). CAV1 expression in mammary epithelial cell lines MCF10A and seven different breast cancer cell lines. (C) Dox-on shCtrl and sh CAV1 MDA-MB-231 cells in the presence of Dox in culture medium were treated with or without Baf A1 (100 nM) as indicated for 2 h. Then cells were collected and immunoblotted with the indicated markers. (D) The sulforhodamine cytotoxicity assay to evaluate Doxo in shCtrl and sh CAV1 MDA-MB-231 cells. shCtrl and sh CAV1 MDA-MB-231 cells were treated with an increasing concentration of Doxo for determination of growth inhibitory IC 50 values. The data were normalized against 100% survival at the lowest inhibitor concentration. Graphs for IC 50 were fitted to the four-parameter logistic equation using Prism8 and shown in the table. Error bars show the percent coefficient of variation. (E) shCtrl and sh CAV1 MDA-MB-231 cells were treated with Doxo (5 μM), HCQ (100 μM), or their combination for 48 h. After treatments, cells were collected and stained with PI and annexin V and then subjected to flow cytometry. (F) Statistical analysis of experiments described in (E) are presented. ∗∗∗p < 0.001; NS > 0.05. (G) shCtrl and sh CAV1 MDA-MB-231 cells were treated as described in (E). Then cells were collected and examined with the indicated markers by western blots. (H) Colony formation assay for the shCtrl and sh CAV1 MDA-MB-231 cells treated as indicated for 48 h. (I) Statistical analysis of experiments described in (H) are presented. ∗∗∗p < 0.001; NS > 0.05. (J) Dox-on shCtrl and sh CAV1 MDA-MB-231 cells were incubated in the presence Dox in culture medium. After transfection with ATG7 siRNA (si ATG7 ) or scrambled siRNA for 48 h, cells were treated with Doxo (5 μM), HCQ (100 μM), or their combination for 48 h. Then cells were stained with PI (red) and observed under a fluoresce microscope. The stable shCtrl and sh CAV1 MDA-MB-231 cells expressed GFP protein when the Dox-on element is activated. Statistical analysis of observed percentage of PI-positive cells is presented. ∗∗p < 0.01; NS > 0.05.

Article Snippet: The chemicals used in this study were: MBCD (Sigma, C4555), cholesterol-water soluble (Sigma, C4951), Baf A1 (Santa Cruz, CAS 88899-55-2), Wort (Santa Cruz, CAS 19545-26-7), cholera toxin subunit B conjugated with Alexa Fluor 594 (CTxB, Invitrogen, C34777), DAB (Dako, K401011), NEM (Sigma, E3876), DTT (Sigma, D9779), human transferrin peroxidase (Rockland antibodies and assays, 009-0334).

Techniques: Expressing, Cytotoxicity Assay, Concentration Assay, Staining, Flow Cytometry, Western Blot, Colony Assay, Incubation, Transfection, Microscopy

(A) Immunofluorescence microscopy confirms Cdu1 depletion dynamics. Cdu1 (green, anti-FLAG), chlamydial inclusion (Hsp60,red), and DNA (DAPI, blue). Scale bar = 10 µm. (B) Expansion microscopy (4× expansion) resolving Cdu1 localization patterns under undegraded and degraded conditions. Scale bar = 10 µm. (C) Cdu1 degradation depends on ubiquitin-proteasome and p97 pathways. Host cells were pretreated with inhibitors for 3 hours (including 1 hour during 5-Ph-IAA treatment) with pan-E1 (TAK-243, 1 µM), proteasome (MG-132, 10 µM; bortezomib, 1 µM), or p97 (CB-5083, 10 µM) inhibitors. Degradation was blocked despite 1-hour 5-Ph-IAA exposure. (D) Quantification of inhibitor effects on Cdu1 degradation. FLAG levels (normalized to OmpA, mean ± SD) from three independent immunoblot replicates (one representative in C). Significance assessed by one-way ANOVA with Tukey Multiple comparisons test (*p < 0.05; n.s., not significant). (E) Immunofluorescence validation of inhibitors. Inclusion-localized Cdu1 signal persists in treated cultures. Scale bar = 10 µm. All experiments were replicated ≥3 times with consistent results.

Journal: bioRxiv

Article Title: Minute-scale control of ubiquitin-mediated degradation reveals dynamics of bacterial secreted effector-functions

doi: 10.1101/2025.11.19.688170

Figure Lengend Snippet: (A) Immunofluorescence microscopy confirms Cdu1 depletion dynamics. Cdu1 (green, anti-FLAG), chlamydial inclusion (Hsp60,red), and DNA (DAPI, blue). Scale bar = 10 µm. (B) Expansion microscopy (4× expansion) resolving Cdu1 localization patterns under undegraded and degraded conditions. Scale bar = 10 µm. (C) Cdu1 degradation depends on ubiquitin-proteasome and p97 pathways. Host cells were pretreated with inhibitors for 3 hours (including 1 hour during 5-Ph-IAA treatment) with pan-E1 (TAK-243, 1 µM), proteasome (MG-132, 10 µM; bortezomib, 1 µM), or p97 (CB-5083, 10 µM) inhibitors. Degradation was blocked despite 1-hour 5-Ph-IAA exposure. (D) Quantification of inhibitor effects on Cdu1 degradation. FLAG levels (normalized to OmpA, mean ± SD) from three independent immunoblot replicates (one representative in C). Significance assessed by one-way ANOVA with Tukey Multiple comparisons test (*p < 0.05; n.s., not significant). (E) Immunofluorescence validation of inhibitors. Inclusion-localized Cdu1 signal persists in treated cultures. Scale bar = 10 µm. All experiments were replicated ≥3 times with consistent results.

Article Snippet: Proteasome inhibitors (MG-132 at 10 μM, bortezomib at 1 μM; Cell Signaling), p97 inhibitor CB-5083 (10 μM; MedChemExpress), and ubiquitin-activating enzyme inhibitor TAK-243 (1 μM; TAK-243) were prepared as 1,000× stock solutions in DMSO.

Techniques: Immunofluorescence, Microscopy, Ubiquitin Proteomics, Western Blot, Biomarker Discovery